Incidental Mutation 'R5689:Dnajc25'
ID443556
Institutional Source Beutler Lab
Gene Symbol Dnajc25
Ensembl Gene ENSMUSG00000070972
Gene NameDnaJ heat shock protein family (Hsp40) member C25
Synonyms2010203O07Rik, 2010109C08Rik
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58995062-59025573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59017716 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 6 (E6G)
Ref Sequence ENSEMBL: ENSMUSP00000118048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095070] [ENSMUST00000148366] [ENSMUST00000150309] [ENSMUST00000152199] [ENSMUST00000153467] [ENSMUST00000174664]
Predicted Effect probably damaging
Transcript: ENSMUST00000095070
AA Change: E125G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092680
Gene: ENSMUSG00000070972
AA Change: E125G

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 2.04e-19 SMART
low complexity region 125 138 N/A INTRINSIC
transmembrane domain 147 164 N/A INTRINSIC
coiled coil region 195 220 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148366
AA Change: E6G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116171
Gene: ENSMUSG00000070972
AA Change: E6G

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150309
SMART Domains Protein: ENSMUSP00000123172
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 4.18e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152199
AA Change: E6G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118048
Gene: ENSMUSG00000070972
AA Change: E6G

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 28 45 N/A INTRINSIC
coiled coil region 76 101 N/A INTRINSIC
transmembrane domain 122 144 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153467
SMART Domains Protein: ENSMUSP00000114320
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 1.12e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174664
SMART Domains Protein: ENSMUSP00000134530
Gene: ENSMUSG00000092345

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 3.9e-16 SMART
G_gamma 94 150 1.06e-6 SMART
GGL 94 150 1.05e-9 SMART
Meta Mutation Damage Score 0.2038 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Dnajc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Dnajc25 APN 4 59017693 nonsense probably null
R0505:Dnajc25 UTSW 4 59020438 missense possibly damaging 0.87
R1195:Dnajc25 UTSW 4 59003415 missense probably damaging 1.00
R2437:Dnajc25 UTSW 4 59020234 missense probably damaging 1.00
R6023:Dnajc25 UTSW 4 59013752 missense possibly damaging 0.53
R6329:Dnajc25 UTSW 4 59013678 missense probably benign 0.33
R7316:Dnajc25 UTSW 4 59017693 nonsense probably null
R7398:Dnajc25 UTSW 4 59017824 critical splice donor site probably null
R7652:Dnajc25 UTSW 4 59020483 missense probably benign 0.01
R7667:Dnajc25 UTSW 4 59020356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTTGGTATACATGCCTCTAAGAG -3'
(R):5'- CGCATCATGTGATACAGCAC -3'

Sequencing Primer
(F):5'- GGTATACATGCCTCTAAGAGTATTGG -3'
(R):5'- TGTGATACAGCACAATGCATAATG -3'
Posted On2016-11-09