Mutagenetix > Incidental Mutation

Incidental Mutation 'R5689:Lnx2'

443561

Institutional Source

Beutler Lab

Gene Symbol

Lnx2

Ensembl Gene

ENSMUSG00000016520

Gene Name

ligand of numb-protein X 2

Synonyms

MMRRC Submission

043322-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R5689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

147016655-147076586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 147029151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 386 (V386E)

Ref Sequence

ENSEMBL: ENSMUSP00000016664 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016664]

AlphaFold

Q91XL2

Predicted Effect

probably damaging
Transcript: ENSMUST00000016664
AA Change: V386E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000016664
Gene: ENSMUSG00000016520
AA Change: V386E

Domain	Start	End	E-Value	Type
RING	51	88	2.06e-6	SMART
low complexity region	103	114	N/A	INTRINSIC
PDZ	242	317	2.25e-17	SMART
PDZ	348	421	2.97e-17	SMART
PDZ	474	553	7.37e-13	SMART
PDZ	606	683	1.27e-16	SMART

Meta Mutation Damage Score

0.9511

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (63/66)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	T	8: 88,324,784	C844F	probably benign	Het
Afdn	T	C	17: 13,855,359	V945A	probably damaging	Het
Aimp2	T	C	5: 143,906,571	D67G	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Atp11b	G	T	3: 35,834,352	V924F	possibly damaging	Het
Atp8b1	C	T	18: 64,564,537	R412H	probably damaging	Het
Cfb	T	A	17: 34,861,794	T76S	probably benign	Het
Cmpk2	A	T	12: 26,469,767	H139L	probably benign	Het
Cypt4	T	C	9: 24,625,246	S11P	possibly damaging	Het
Dbx1	A	G	7: 49,632,771	F229L	probably damaging	Het
Dnah6	T	A	6: 73,021,227	M4071L	probably benign	Het
Dnah7a	A	G	1: 53,405,698	V3949A	possibly damaging	Het
Dnajc25	A	G	4: 59,017,716	E6G	probably damaging	Het
Dync2h1	C	A	9: 7,169,689	V263F	probably damaging	Het
Eno4	T	A	19: 58,970,656	D403E	probably benign	Het
Evi5l	C	T	8: 4,205,460	Q542*	probably null	Het
Fam135a	A	G	1: 24,029,053	S12P	probably benign	Het
Fam198a	T	C	9: 121,965,688	F303L	probably damaging	Het
Flnc	G	A	6: 29,441,592	A458T	probably benign	Het
Fnip1	T	C	11: 54,502,289	V517A	probably damaging	Het
Galc	G	T	12: 98,212,986	H361N	possibly damaging	Het
Gcnt1	T	A	19: 17,329,404	D319V	probably damaging	Het
Gm26996	T	C	6: 130,578,295		noncoding transcript	Het
Gm5321	A	T	7: 6,019,269		noncoding transcript	Het
Grin3b	T	C	10: 79,974,631	L657P	probably damaging	Het
Gstm5	T	C	3: 107,896,665	F54S	probably damaging	Het
Ilk	C	A	7: 105,741,650	L267I	probably benign	Het
Lifr	A	G	15: 7,184,804	Y713C	probably damaging	Het
Lrch1	T	C	14: 74,786,324	E587G	probably damaging	Het
Olfr1512	C	T	14: 52,372,757	V99M	possibly damaging	Het
Osgin1	A	G	8: 119,444,989	*173W	probably null	Het
Pcdhga7	C	A	18: 37,716,683	P581H	probably damaging	Het
Pde4dip	A	T	3: 97,692,367	L2384*	probably null	Het
Phf12	T	A	11: 78,023,725	N115K	probably damaging	Het
Pmel	A	G	10: 128,716,301	T335A	probably damaging	Het
Polr3e	C	A	7: 120,940,689	T579K	possibly damaging	Het
Ptprc	A	G	1: 138,117,777	V164A	probably benign	Het
Rapsn	T	C	2: 91,035,924	F43S	probably damaging	Het
Rarb	T	A	14: 16,434,177	I334F	probably damaging	Het
Rev3l	T	C	10: 39,794,958	Y167H	probably damaging	Het
Rnf146	T	C	10: 29,347,804	T29A	probably benign	Het
Rsf1	GC	GCGGCGGCGCC	7: 97,579,934		probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc5a10	C	T	11: 61,707,884	M223I	probably benign	Het
Slc7a11	C	G	3: 50,372,331	V494L	probably benign	Het
Slitrk6	C	T	14: 110,752,126	E50K	probably benign	Het
Smg8	A	G	11: 87,085,123	F544S	probably damaging	Het
Tnpo3	T	C	6: 29,571,064	M444V	possibly damaging	Het
Trav7d-4	G	A	14: 52,770,194	R48H	probably damaging	Het
Trim50	A	T	5: 135,353,662	T123S	probably damaging	Het
Trpc4ap	C	G	2: 155,671,035		probably null	Het
Ttn	T	A	2: 76,788,276	R14475S	probably damaging	Het
Uts2	A	T	4: 150,999,108	T59S	possibly damaging	Het
Vmn1r52	T	C	6: 90,179,250	S179P	possibly damaging	Het
Vmn2r116	A	G	17: 23,397,719	H537R	probably benign	Het
Vps16	C	T	2: 130,439,091	Q226*	probably null	Het
Zfhx2	T	C	14: 55,073,903	T445A	possibly damaging	Het
Zfp638	T	C	6: 83,929,072	V73A	probably damaging	Het

Other mutations in Lnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02593:Lnx2	APN	5	147033015	missense	possibly damaging	0.81
IGL02657:Lnx2	APN	5	147028174	missense	probably damaging	1.00
IGL02820:Lnx2	APN	5	147042067	missense	probably damaging	0.98
R0051:Lnx2	UTSW	5	147029353	missense	probably damaging	0.96
R0389:Lnx2	UTSW	5	147019040	missense	possibly damaging	0.51
R0482:Lnx2	UTSW	5	147018961	missense	probably damaging	0.99
R1601:Lnx2	UTSW	5	147033519	missense	probably damaging	0.99
R1604:Lnx2	UTSW	5	147029325	missense	probably benign	0.02
R1647:Lnx2	UTSW	5	147027342	missense	probably benign	0.04
R3001:Lnx2	UTSW	5	147019015	missense	probably benign	0.00
R3002:Lnx2	UTSW	5	147019015	missense	probably benign	0.00
R4734:Lnx2	UTSW	5	147029137	missense	probably damaging	1.00
R4960:Lnx2	UTSW	5	147019040	missense	probably benign	0.09
R5387:Lnx2	UTSW	5	147028154	missense	probably benign	0.00
R5950:Lnx2	UTSW	5	147024350	critical splice donor site	probably null
R6161:Lnx2	UTSW	5	147042026	splice site	probably null
R6623:Lnx2	UTSW	5	147024487	missense	probably damaging	1.00
R7086:Lnx2	UTSW	5	147020178	splice site	probably null
R7320:Lnx2	UTSW	5	147020133	missense	possibly damaging	0.71
R7701:Lnx2	UTSW	5	147024523	missense	probably damaging	1.00
R7887:Lnx2	UTSW	5	147019043	missense	probably damaging	1.00
R8153:Lnx2	UTSW	5	147028096	missense	probably benign
R8267:Lnx2	UTSW	5	147029091	missense	probably damaging	1.00
R8298:Lnx2	UTSW	5	147024517	missense	probably benign	0.05
R8384:Lnx2	UTSW	5	147029328	missense	probably benign	0.01
R8446:Lnx2	UTSW	5	147033359	missense	probably benign
R8971:Lnx2	UTSW	5	147033426	missense	probably benign
R9378:Lnx2	UTSW	5	147024370	missense	probably benign	0.16
R9468:Lnx2	UTSW	5	147042479	start gained	probably benign
R9711:Lnx2	UTSW	5	147024566	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTGTAGATTCTGAAGGCTG -3'
(R):5'- ATGACATCAGCAACGTGTCCC -3'

Sequencing Primer
(F):5'- CTGAAGGCTGCTTTTTAGATAACC -3'
(R):5'- ACGCTGCAGCTGACAGTG -3'

Posted On

2016-11-09