Incidental Mutation 'R5689:Polr3e'
ID 443572
Institutional Source Beutler Lab
Gene Symbol Polr3e
Ensembl Gene ENSMUSG00000030880
Gene Name polymerase (RNA) III (DNA directed) polypeptide E
Synonyms RPC5, Sin
MMRRC Submission 043322-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R5689 (G1)
Quality Score 167
Status Validated
Chromosome 7
Chromosomal Location 120516967-120546655 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 120539912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 579 (T579K)
Ref Sequence ENSEMBL: ENSMUSP00000102092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033173] [ENSMUST00000106483] [ENSMUST00000207481]
AlphaFold Q9CZT4
Predicted Effect possibly damaging
Transcript: ENSMUST00000033173
AA Change: T579K

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033173
Gene: ENSMUSG00000030880
AA Change: T579K

DomainStartEndE-ValueType
Pfam:Sin_N 5 432 7.1e-161 PFAM
coiled coil region 458 491 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106483
AA Change: T579K

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102092
Gene: ENSMUSG00000030880
AA Change: T579K

DomainStartEndE-ValueType
Pfam:Sin_N 4 29 2.8e-10 PFAM
Pfam:Sin_N 29 408 6.9e-141 PFAM
coiled coil region 432 465 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207481
AA Change: T553K

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209014
Meta Mutation Damage Score 0.5193 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 89,051,412 (GRCm39) C844F probably benign Het
Afdn T C 17: 14,075,621 (GRCm39) V945A probably damaging Het
Aimp2 T C 5: 143,843,389 (GRCm39) D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 (GRCm39) T115I probably benign Het
Atp11b G T 3: 35,888,501 (GRCm39) V924F possibly damaging Het
Atp8b1 C T 18: 64,697,608 (GRCm39) R412H probably damaging Het
Cfb T A 17: 35,080,770 (GRCm39) T76S probably benign Het
Cmpk2 A T 12: 26,519,766 (GRCm39) H139L probably benign Het
Cypt4 T C 9: 24,536,542 (GRCm39) S11P possibly damaging Het
Dbx1 A G 7: 49,282,519 (GRCm39) F229L probably damaging Het
Dnah6 T A 6: 72,998,210 (GRCm39) M4071L probably benign Het
Dnah7a A G 1: 53,444,857 (GRCm39) V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 (GRCm39) E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 (GRCm39) V263F probably damaging Het
Eno4 T A 19: 58,959,088 (GRCm39) D403E probably benign Het
Evi5l C T 8: 4,255,460 (GRCm39) Q542* probably null Het
Fam135a A G 1: 24,068,134 (GRCm39) S12P probably benign Het
Flnc G A 6: 29,441,591 (GRCm39) A458T probably benign Het
Fnip1 T C 11: 54,393,115 (GRCm39) V517A probably damaging Het
Galc G T 12: 98,179,245 (GRCm39) H361N possibly damaging Het
Gask1a T C 9: 121,794,754 (GRCm39) F303L probably damaging Het
Gcnt1 T A 19: 17,306,768 (GRCm39) D319V probably damaging Het
Gm26996 T C 6: 130,555,258 (GRCm39) noncoding transcript Het
Gm5321 A T 7: 6,022,268 (GRCm39) noncoding transcript Het
Grin3b T C 10: 79,810,465 (GRCm39) L657P probably damaging Het
Gstm5 T C 3: 107,803,981 (GRCm39) F54S probably damaging Het
Ilk C A 7: 105,390,857 (GRCm39) L267I probably benign Het
Lifr A G 15: 7,214,285 (GRCm39) Y713C probably damaging Het
Lnx2 A T 5: 146,965,961 (GRCm39) V386E probably damaging Het
Lrch1 T C 14: 75,023,764 (GRCm39) E587G probably damaging Het
Or10g3 C T 14: 52,610,214 (GRCm39) V99M possibly damaging Het
Osgin1 A G 8: 120,171,728 (GRCm39) *173W probably null Het
Pcdhga7 C A 18: 37,849,736 (GRCm39) P581H probably damaging Het
Pde4dip A T 3: 97,599,683 (GRCm39) L2384* probably null Het
Phf12 T A 11: 77,914,551 (GRCm39) N115K probably damaging Het
Pmel A G 10: 128,552,170 (GRCm39) T335A probably damaging Het
Ptprc A G 1: 138,045,515 (GRCm39) V164A probably benign Het
Rapsn T C 2: 90,866,269 (GRCm39) F43S probably damaging Het
Rarb T A 14: 16,434,177 (GRCm38) I334F probably damaging Het
Rev3l T C 10: 39,670,954 (GRCm39) Y167H probably damaging Het
Rnf146 T C 10: 29,223,800 (GRCm39) T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,229,141 (GRCm39) probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc5a10 C T 11: 61,598,710 (GRCm39) M223I probably benign Het
Slc7a11 C G 3: 50,326,780 (GRCm39) V494L probably benign Het
Slitrk6 C T 14: 110,989,558 (GRCm39) E50K probably benign Het
Smg8 A G 11: 86,975,949 (GRCm39) F544S probably damaging Het
Tnpo3 T C 6: 29,571,063 (GRCm39) M444V possibly damaging Het
Trav7d-4 G A 14: 53,007,651 (GRCm39) R48H probably damaging Het
Trim50 A T 5: 135,382,516 (GRCm39) T123S probably damaging Het
Trpc4ap C G 2: 155,512,955 (GRCm39) probably null Het
Ttn T A 2: 76,618,620 (GRCm39) R14475S probably damaging Het
Uts2 A T 4: 151,083,565 (GRCm39) T59S possibly damaging Het
Vmn1r52 T C 6: 90,156,232 (GRCm39) S179P possibly damaging Het
Vmn2r116 A G 17: 23,616,693 (GRCm39) H537R probably benign Het
Vps16 C T 2: 130,281,011 (GRCm39) Q226* probably null Het
Zfhx2 T C 14: 55,311,360 (GRCm39) T445A possibly damaging Het
Zfp638 T C 6: 83,906,054 (GRCm39) V73A probably damaging Het
Other mutations in Polr3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Polr3e APN 7 120,540,034 (GRCm39) nonsense probably null
IGL01664:Polr3e APN 7 120,530,540 (GRCm39) splice site probably benign
IGL01980:Polr3e APN 7 120,539,519 (GRCm39) splice site probably benign
IGL02027:Polr3e APN 7 120,530,186 (GRCm39) missense probably damaging 1.00
IGL02208:Polr3e APN 7 120,531,363 (GRCm39) missense probably damaging 0.99
IGL02549:Polr3e APN 7 120,538,982 (GRCm39) missense probably damaging 1.00
IGL03338:Polr3e APN 7 120,536,843 (GRCm39) missense probably benign 0.06
R1192:Polr3e UTSW 7 120,532,531 (GRCm39) missense probably benign 0.03
R1328:Polr3e UTSW 7 120,533,046 (GRCm39) splice site probably benign
R1435:Polr3e UTSW 7 120,540,011 (GRCm39) missense probably benign 0.16
R1528:Polr3e UTSW 7 120,539,820 (GRCm39) missense probably damaging 1.00
R1754:Polr3e UTSW 7 120,538,521 (GRCm39) critical splice donor site probably null
R1924:Polr3e UTSW 7 120,539,820 (GRCm39) missense probably damaging 1.00
R2169:Polr3e UTSW 7 120,531,360 (GRCm39) missense probably damaging 1.00
R2201:Polr3e UTSW 7 120,531,465 (GRCm39) missense probably benign
R2362:Polr3e UTSW 7 120,541,787 (GRCm39) missense probably damaging 1.00
R2696:Polr3e UTSW 7 120,532,600 (GRCm39) missense probably damaging 1.00
R4416:Polr3e UTSW 7 120,538,280 (GRCm39) critical splice donor site probably null
R5278:Polr3e UTSW 7 120,522,184 (GRCm39) missense possibly damaging 0.67
R5560:Polr3e UTSW 7 120,522,172 (GRCm39) missense possibly damaging 0.83
R5790:Polr3e UTSW 7 120,527,190 (GRCm39) missense probably damaging 1.00
R6242:Polr3e UTSW 7 120,539,690 (GRCm39) missense possibly damaging 0.62
R6317:Polr3e UTSW 7 120,527,205 (GRCm39) missense possibly damaging 0.49
R6334:Polr3e UTSW 7 120,527,222 (GRCm39) missense possibly damaging 0.87
R6891:Polr3e UTSW 7 120,543,873 (GRCm39) missense probably damaging 0.98
R7110:Polr3e UTSW 7 120,539,510 (GRCm39) splice site probably null
R7771:Polr3e UTSW 7 120,539,801 (GRCm39) missense probably benign
R7809:Polr3e UTSW 7 120,523,449 (GRCm39) missense probably damaging 1.00
R8431:Polr3e UTSW 7 120,530,528 (GRCm39) missense probably damaging 0.99
R8753:Polr3e UTSW 7 120,539,540 (GRCm39) missense possibly damaging 0.55
R9038:Polr3e UTSW 7 120,536,906 (GRCm39) missense possibly damaging 0.91
R9049:Polr3e UTSW 7 120,538,462 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGATCAAGGAGGAACCC -3'
(R):5'- TCCTAAGAAGGCGAAGACCG -3'

Sequencing Primer
(F):5'- AGGAGCCCATGGACACTG -3'
(R):5'- CTCCTGAAGGGCTCTGATTGAC -3'
Posted On 2016-11-09