Incidental Mutation 'R5689:Fam198a'
ID443578
Institutional Source Beutler Lab
Gene Symbol Fam198a
Ensembl Gene ENSMUSG00000038233
Gene Namefamily with sequence similarity 198, member A
Synonyms
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121950988-121980209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121965688 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 303 (F303L)
Ref Sequence ENSEMBL: ENSMUSP00000150724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043011] [ENSMUST00000213773] [ENSMUST00000214536] [ENSMUST00000215990]
Predicted Effect probably benign
Transcript: ENSMUST00000043011
AA Change: F303L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040221
Gene: ENSMUSG00000038233
AA Change: F303L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
Pfam:FAM198 220 544 1.3e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213773
AA Change: F303L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably damaging
Transcript: ENSMUST00000214536
AA Change: F303L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214808
Predicted Effect probably benign
Transcript: ENSMUST00000215990
AA Change: F303L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.6987 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Fam198a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Fam198a APN 9 121978335 missense probably damaging 1.00
IGL01722:Fam198a APN 9 121965083 missense possibly damaging 0.92
IGL02733:Fam198a APN 9 121965028 missense probably benign 0.00
R0514:Fam198a UTSW 9 121978352 missense possibly damaging 0.62
R1344:Fam198a UTSW 9 121978386 missense probably damaging 0.98
R1868:Fam198a UTSW 9 121965427 missense possibly damaging 0.71
R2279:Fam198a UTSW 9 121965602 missense probably benign 0.00
R3237:Fam198a UTSW 9 121964869 missense possibly damaging 0.83
R3753:Fam198a UTSW 9 121965833 missense probably damaging 1.00
R4967:Fam198a UTSW 9 121965718 missense probably damaging 1.00
R5192:Fam198a UTSW 9 121965661 missense probably benign
R5196:Fam198a UTSW 9 121965661 missense probably benign
R5560:Fam198a UTSW 9 121978223 missense possibly damaging 0.94
R5588:Fam198a UTSW 9 121965181 nonsense probably null
R7017:Fam198a UTSW 9 121965986 critical splice donor site probably null
R7037:Fam198a UTSW 9 121965526 missense possibly damaging 0.61
R7041:Fam198a UTSW 9 121965401 missense probably damaging 0.98
R7045:Fam198a UTSW 9 121965641 missense probably damaging 1.00
R7170:Fam198a UTSW 9 121978235 missense probably damaging 1.00
R7505:Fam198a UTSW 9 121976417 missense probably benign 0.00
R7704:Fam198a UTSW 9 121951085 start gained probably benign
R7751:Fam198a UTSW 9 121964821 missense probably benign 0.01
V1662:Fam198a UTSW 9 121965025 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGTTCCACCATGGTTCATG -3'
(R):5'- CAGAGAGTTCTGGTCCTCATCTG -3'

Sequencing Primer
(F):5'- CTACTGGTCCATGGGAAAGTG -3'
(R):5'- CTCATCTGGGTCTCTTAGGTGC -3'
Posted On2016-11-09