Mutagenetix > Incidental Mutation

Incidental Mutation 'H8562:Otogl'

44358

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

H8562 (G3) of strain 604

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107910956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 19 (Y19C)

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

AlphaFold

F7A4A7

Predicted Effect

probably benign
Transcript: ENSMUST00000165341
AA Change: Y19C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: Y19C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Meta Mutation Damage Score

0.0842

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

96% (109/114)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	A	G	19: 7,422,921	K251E	probably benign	Het
2810021J22Rik	T	C	11: 58,880,891	C400R	probably damaging	Het
4930519F16Rik	A	T	X: 103,255,857		noncoding transcript	Het
5430402E10Rik	G	T	X: 77,922,734	H117Q	probably damaging	Het
Abca15	T	C	7: 120,374,854		probably benign	Het
Abca8a	A	G	11: 110,043,009	I1190T	probably benign	Het
Acmsd	T	C	1: 127,749,058	Y107H	probably benign	Het
Adcy5	A	G	16: 35,267,181	I471V	probably damaging	Het
Aff2	G	A	X: 69,848,926	A939T	unknown	Het
Ampd2	C	A	3: 108,081,111	A11S	probably benign	Het
Aoah	T	A	13: 20,816,524	C43S	probably damaging	Het
Apobec4	T	C	1: 152,757,174	S318P	probably damaging	Het
Arid2	C	T	15: 96,369,546	P636S	possibly damaging	Het
Atp13a3	A	T	16: 30,359,725	C164*	probably null	Het
Avl9	G	A	6: 56,757,310	A625T	probably damaging	Het
Bco1	G	T	8: 117,105,647		probably benign	Het
Brd3	C	T	2: 27,450,533	G555S	possibly damaging	Het
Brd4	A	T	17: 32,229,403		probably benign	Het
Btbd7	A	G	12: 102,788,302	V735A	probably benign	Het
C2cd2	G	T	16: 97,879,640	Q325K	possibly damaging	Het
Carmil1	A	G	13: 24,064,647	V485A	probably benign	Het
Casz1	T	C	4: 148,933,451	L113P	probably damaging	Het
Ccdc3	T	C	2: 5,138,205	L91S	probably damaging	Het
Cd180	A	G	13: 102,705,418	K324R	probably benign	Het
Cd200r4	A	G	16: 44,833,373	T132A	possibly damaging	Het
Cops7a	A	G	6: 124,962,453		probably benign	Het
Cyp2c29	A	T	19: 39,309,662	N217I	probably damaging	Het
Dapk1	C	A	13: 60,761,312	H1246Q	probably damaging	Het
Dmbt1	T	A	7: 131,112,076	C1450*	probably null	Het
Dnah10	T	A	5: 124,829,529	M4151K	probably damaging	Het
Dnaic1	C	A	4: 41,629,833	F452L	possibly damaging	Het
Dync1h1	T	C	12: 110,616,807	M446T	probably benign	Het
Dytn	A	C	1: 63,674,912	S143A	possibly damaging	Het
E130308A19Rik	T	A	4: 59,691,033	L289Q	possibly damaging	Het
Efemp2	G	T	19: 5,480,649	V250L	probably benign	Het
Elmo1	T	C	13: 20,280,863	S201P	probably damaging	Het
Fam208b	A	T	13: 3,577,000	S983R	probably damaging	Het
Fam222b	T	A	11: 78,154,578	C194S	probably damaging	Het
Fam91a1	G	A	15: 58,427,121		probably null	Het
Fcf1	T	A	12: 84,980,612		probably benign	Het
Fnip1	T	A	11: 54,480,297	F134L	probably damaging	Het
Fyn	T	C	10: 39,511,954	S69P	probably benign	Het
Gabbr1	T	C	17: 37,071,949	Y845H	probably damaging	Het
Gfra2	C	T	14: 70,978,378	T169M	possibly damaging	Het
Gm13083	T	A	4: 143,615,350		probably benign	Het
Gm1966	A	G	7: 106,603,149	F296S	probably damaging	Het
Gm5435	T	C	12: 82,495,675		noncoding transcript	Het
Gm7251	A	G	13: 49,805,672	Y94H	probably damaging	Het
Heatr1	T	A	13: 12,408,713	N530K	probably benign	Het
Hist1h2bn	T	C	13: 21,754,478	V119A	probably benign	Het
Icam5	A	T	9: 21,035,146	E355V	probably benign	Het
Ighv3-6	A	G	12: 114,288,538		probably benign	Het
Intu	T	C	3: 40,692,673	S659P	probably damaging	Het
Ivns1abp	T	C	1: 151,354,695	V198A	probably damaging	Het
Katnb1	T	A	8: 95,095,510		probably benign	Het
Kcna5	T	C	6: 126,533,423	S581G	probably damaging	Het
Kif23	A	G	9: 61,924,065	V741A	probably benign	Het
Lbr	A	T	1: 181,820,668		probably benign	Het
Loxhd1	A	C	18: 77,341,931	T508P	possibly damaging	Het
Lrrk2	T	A	15: 91,673,358	N26K	probably benign	Het
Ly96	A	T	1: 16,691,694	K41N	probably damaging	Het
Lypd1	C	T	1: 125,910,537		probably benign	Het
Macf1	A	G	4: 123,466,040	V1817A	probably benign	Het
Mknk2	A	G	10: 80,668,934		probably benign	Het
Mmp19	A	T	10: 128,795,601	I117L	probably benign	Het
Mmrn1	G	A	6: 60,958,180	G220D	probably damaging	Het
Mtrr	T	C	13: 68,564,377	H630R	probably damaging	Het
Nfat5	T	C	8: 107,339,382		probably benign	Het
Ngef	C	A	1: 87,487,807	K288N	possibly damaging	Het
Nkain4	T	C	2: 180,943,145	E71G	probably benign	Het
Odc1	T	C	12: 17,548,037	Y122H	probably benign	Het
Olfr384	T	C	11: 73,603,447	I289T	probably damaging	Het
Olfr715	C	A	7: 107,129,241	A51S	probably benign	Het
Olfr919	C	A	9: 38,697,910	G156V	probably damaging	Het
Osbpl3	A	T	6: 50,347,466	N190K	probably benign	Het
Osgepl1	T	C	1: 53,315,039	V54A	probably damaging	Het
Pop1	T	C	15: 34,530,212	S919P	probably benign	Het
Prl8a9	A	G	13: 27,562,601		probably benign	Het
Prr14l	A	T	5: 32,793,728	V1907D	probably damaging	Het
Ptprn	T	C	1: 75,254,620	T547A	possibly damaging	Het
Rdh14	G	T	12: 10,394,709	V187F	probably damaging	Het
Rev1	A	G	1: 38,056,767	L853P	probably damaging	Het
Robo4	T	C	9: 37,405,810		probably benign	Het
Ryr2	A	G	13: 11,717,141		probably benign	Het
Sec16a	G	A	2: 26,441,505	P166L	probably benign	Het
Slc6a19	G	A	13: 73,700,124		probably benign	Het
Slco4c1	T	A	1: 96,842,485	T285S	probably benign	Het
Speg	G	T	1: 75,415,597	A1633S	probably benign	Het
Srpk1	T	A	17: 28,602,733	T236S	probably benign	Het
Stxbp5	T	C	10: 9,769,443	N262S	probably benign	Het
Suco	T	C	1: 161,852,851	E317G	probably damaging	Het
Syk	A	G	13: 52,640,621	N441D	probably damaging	Het
Syt17	T	C	7: 118,408,069	K334R	probably benign	Het
Sytl5	A	T	X: 9,960,096	H436L	probably benign	Het
Thada	A	G	17: 84,446,544	L333P	probably damaging	Het
Thap12	T	C	7: 98,715,107	Y161H	probably damaging	Het
Thbs2	C	T	17: 14,671,453	V941I	probably benign	Het
Tktl1	A	T	X: 74,181,864	E72V	probably damaging	Het
Tm4sf5	T	A	11: 70,505,512		probably benign	Het
Urb1	T	A	16: 90,769,469	M1477L	probably benign	Het
Vcp	T	A	4: 42,982,596	I699F	probably damaging	Het
Vmn1r232	T	C	17: 20,913,394	T315A	probably benign	Het
Vmn2r100	T	A	17: 19,521,490	W155R	possibly damaging	Het
Vmn2r19	T	C	6: 123,315,902	I301T	possibly damaging	Het
Wwc2	A	G	8: 47,920,666	V55A	possibly damaging	Het
Xirp2	A	G	2: 67,515,457	T2681A	probably benign	Het
Zfp39	C	A	11: 58,900,686	L58F	probably damaging	Het
Zfp612	T	C	8: 110,090,038	F587L	probably damaging	Het
Zfp810	T	C	9: 22,279,091	R174G	probably benign	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R7988:Otogl	UTSW	10	107895776	missense	probably damaging	1.00
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
R8680:Otogl	UTSW	10	107912075	critical splice donor site	probably null
R9025:Otogl	UTSW	10	107777571	missense	probably damaging	0.99
R9090:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9223:Otogl	UTSW	10	107854344	missense	probably damaging	0.99
R9268:Otogl	UTSW	10	107781056	missense	probably damaging	1.00
R9271:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9356:Otogl	UTSW	10	107782029	missense	probably damaging	1.00
R9484:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R9484:Otogl	UTSW	10	107901295	missense	probably damaging	1.00
R9571:Otogl	UTSW	10	107762503	missense	possibly damaging	0.94
R9731:Otogl	UTSW	10	107899467	missense	probably damaging	1.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GTGGACCACACCAAGGCTTCTTAC -3'
(R):5'- AGGGCCAGCTCTAGAATAGCTCTG -3'

Sequencing Primer
(F):5'- CAAGGCTTCTTACAAATACGAAAAGG -3'
(R):5'- ATAGCAGAACCCAGAGCAAG -3'

Posted On

2013-06-11