Incidental Mutation 'R5689:Pmel'
ID443584
Institutional Source Beutler Lab
Gene Symbol Pmel
Ensembl Gene ENSMUSG00000025359
Gene Namepremelanosome protein
SynonymsPmel17, gp100, D10H12S53E, Si, D12S53Eh, gp87
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128704195-128720238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128716301 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 335 (T335A)
Ref Sequence ENSEMBL: ENSMUSP00000051869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000054125] [ENSMUST00000217836] [ENSMUST00000219157] [ENSMUST00000219834]
Predicted Effect probably benign
Transcript: ENSMUST00000026414
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054125
AA Change: T335A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051869
Gene: ENSMUSG00000025359
AA Change: T335A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
PKD 228 310 3.17e-7 SMART
low complexity region 326 348 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217836
Predicted Effect probably benign
Transcript: ENSMUST00000219157
Predicted Effect probably benign
Transcript: ENSMUST00000219834
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: This mutation affects the viability of melanoblasts, resulting in random occurrence of white, partially white or gray hairs, and fully pigmented hairs that together display as varying intensities of silvering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Pmel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Pmel APN 10 128716089 missense possibly damaging 0.83
IGL01788:Pmel APN 10 128717832 missense probably damaging 1.00
IGL03205:Pmel APN 10 128716448 missense probably benign 0.05
R0288:Pmel UTSW 10 128714306 missense probably benign
R0944:Pmel UTSW 10 128715257 missense possibly damaging 0.82
R1220:Pmel UTSW 10 128714060 missense probably benign 0.01
R1429:Pmel UTSW 10 128718992 splice site probably null
R5222:Pmel UTSW 10 128718984 splice site probably null
R5767:Pmel UTSW 10 128714381 missense probably damaging 0.99
R6145:Pmel UTSW 10 128715935 missense probably damaging 1.00
R7287:Pmel UTSW 10 128715226 nonsense probably null
R7410:Pmel UTSW 10 128716484 missense probably benign 0.22
R7978:Pmel UTSW 10 128715950 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAGATGGTACTGGGACC -3'
(R):5'- TGGTTCCAGAAGGCCTTGTG -3'

Sequencing Primer
(F):5'- GATGTCACTCACACTTACCTGGAG -3'
(R):5'- CAGAAGGCCTTGTGGGTGTG -3'
Posted On2016-11-09