Incidental Mutation 'R5689:Fnip1'
ID443585
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
MMRRC Submission 043322-MU
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54502289 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 517 (V517A)
Ref Sequence ENSEMBL: ENSMUSP00000049026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]
Predicted Effect probably damaging
Transcript: ENSMUST00000046835
AA Change: V517A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: V517A

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143650
AA Change: V493A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992
AA Change: V493A

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Meta Mutation Damage Score 0.3121 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54515499 missense probably benign 0.41
R7866:Fnip1 UTSW 11 54465402 start gained probably benign
R7939:Fnip1 UTSW 11 54502267 missense probably damaging 1.00
R7943:Fnip1 UTSW 11 54502388 missense probably damaging 1.00
R8429:Fnip1 UTSW 11 54475696 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACAGCTGTTTAGAAACACAGC -3'
(R):5'- CTAAAGTGGTAGTAATCACTGTGC -3'

Sequencing Primer
(F):5'- AACAAAACCTGTTCACCTTTCTC -3'
(R):5'- CTGTGCCTGGCATAACAATG -3'
Posted On2016-11-09