Incidental Mutation 'R5689:Slc5a10'
ID443586
Institutional Source Beutler Lab
Gene Symbol Slc5a10
Ensembl Gene ENSMUSG00000042371
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 10
SynonymsC330021F16Rik, SGLT5
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61672781-61720826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61707884 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 223 (M223I)
Ref Sequence ENSEMBL: ENSMUSP00000118196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051552] [ENSMUST00000093019] [ENSMUST00000148584] [ENSMUST00000151780]
Predicted Effect probably benign
Transcript: ENSMUST00000051552
AA Change: M252I

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054407
Gene: ENSMUSG00000042371
AA Change: M252I

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093019
SMART Domains Protein: ENSMUSP00000090697
Gene: ENSMUSG00000042377

DomainStartEndE-ValueType
Pfam:DUF1669 15 309 1.8e-120 PFAM
Pfam:PLDc_2 165 304 5.5e-11 PFAM
low complexity region 316 336 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
low complexity region 721 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128196
Predicted Effect probably benign
Transcript: ENSMUST00000148584
AA Change: M252I

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114523
Gene: ENSMUSG00000042371
AA Change: M252I

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151780
AA Change: M223I

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118196
Gene: ENSMUSG00000042371
AA Change: M223I

DomainStartEndE-ValueType
Pfam:SSF 48 185 3.5e-44 PFAM
Pfam:SSF 182 450 5e-79 PFAM
transmembrane domain 484 506 N/A INTRINSIC
transmembrane domain 547 566 N/A INTRINSIC
Meta Mutation Damage Score 0.1222 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sodium/glucose transporter family. Members of this family are sodium-dependent transporters and can be divided into two subfamilies based on sequence homology, one that co-transports sugars and the second that transports molecules such as ascorbate, choline, iodide, lipoate, monocaroboxylates, and pantothenate. The protein encoded by this gene has the highest affinity for mannose and has been reported to be most highly expressed in the kidney. This protein may function as a kidney-specific, sodium-dependent mannose and fructose co-transporter. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired fructose reabsorption in the kidneys and exacerbated hepatic steatosis induced by fructose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Slc5a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Slc5a10 APN 11 61715136 missense probably damaging 0.99
IGL02215:Slc5a10 APN 11 61673912 missense probably benign 0.00
IGL02354:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02361:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02573:Slc5a10 APN 11 61673072 missense possibly damaging 0.89
IGL02712:Slc5a10 APN 11 61707806 nonsense probably null
R1535:Slc5a10 UTSW 11 61673941 missense possibly damaging 0.65
R1659:Slc5a10 UTSW 11 61676244 missense possibly damaging 0.94
R1698:Slc5a10 UTSW 11 61709602 missense probably benign 0.44
R2161:Slc5a10 UTSW 11 61719934 missense probably null 0.17
R4948:Slc5a10 UTSW 11 61719882 missense probably damaging 0.98
R5686:Slc5a10 UTSW 11 61678566 missense probably benign 0.19
R7398:Slc5a10 UTSW 11 61673579 missense probably benign
R7769:Slc5a10 UTSW 11 61673647 missense probably damaging 1.00
R8234:Slc5a10 UTSW 11 61673281 missense probably benign
R8257:Slc5a10 UTSW 11 61715047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAACCCTAGCAGCCTAG -3'
(R):5'- AACCTCAACCTTCCTGGAGC -3'

Sequencing Primer
(F):5'- TAGCAGCCTAGATGGACCC -3'
(R):5'- CCAGTTTGATGCATGAAGTTATCTG -3'
Posted On2016-11-09