Incidental Mutation 'R5689:Rarb'
ID443591
Institutional Source Beutler Lab
Gene Symbol Rarb
Ensembl Gene ENSMUSG00000017491
Gene Nameretinoic acid receptor, beta
SynonymsRAR beta 2, Hap, RARbeta2
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location16430839-16819156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16434177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 334 (I334F)
Ref Sequence ENSEMBL: ENSMUSP00000152980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000225921]
Predicted Effect probably benign
Transcript: ENSMUST00000017629
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063750
AA Change: I380F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491
AA Change: I380F

DomainStartEndE-ValueType
low complexity region 52 75 N/A INTRINSIC
ZnF_C4 78 149 3.77e-40 SMART
HOLI 223 381 1.72e-34 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223576
Predicted Effect probably damaging
Transcript: ENSMUST00000225921
AA Change: I334F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7920 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Rarb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Rarb APN 14 16443791 nonsense probably null
IGL01483:Rarb APN 14 16432273 splice site probably benign
IGL01591:Rarb APN 14 16434207 missense possibly damaging 0.93
IGL01769:Rarb APN 14 16443760 missense probably damaging 0.97
IGL01782:Rarb APN 14 16434180 missense probably damaging 1.00
IGL01866:Rarb APN 14 16443751 missense probably benign 0.17
IGL03299:Rarb APN 14 16434168 missense probably damaging 1.00
IGL03134:Rarb UTSW 14 16436910 missense probably damaging 0.99
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0849:Rarb UTSW 14 16434293 missense probably damaging 1.00
R1067:Rarb UTSW 14 16436769 missense probably damaging 0.98
R1314:Rarb UTSW 14 16508932 critical splice donor site probably null
R1416:Rarb UTSW 14 16435177 missense possibly damaging 0.82
R2894:Rarb UTSW 14 16435146 missense probably damaging 1.00
R4637:Rarb UTSW 14 16574875 missense possibly damaging 0.51
R4950:Rarb UTSW 14 16432085 unclassified probably benign
R5420:Rarb UTSW 14 16434249 missense possibly damaging 0.89
R5456:Rarb UTSW 14 16436843 missense probably damaging 1.00
R5635:Rarb UTSW 14 16443788 missense probably damaging 1.00
R5708:Rarb UTSW 14 16548545 missense probably damaging 0.99
R5819:Rarb UTSW 14 16443820 missense possibly damaging 0.68
R5935:Rarb UTSW 14 16434264 missense probably damaging 1.00
R6264:Rarb UTSW 14 16818819 missense probably benign 0.31
R6823:Rarb UTSW 14 16443824 missense probably damaging 1.00
R6975:Rarb UTSW 14 16574942 missense possibly damaging 0.92
R7295:Rarb UTSW 14 16508932 critical splice donor site probably null
R7402:Rarb UTSW 14 16548419 missense probably damaging 1.00
R7849:Rarb UTSW 14 16548473 missense probably damaging 1.00
X0065:Rarb UTSW 14 16434303 missense possibly damaging 0.89
Z1177:Rarb UTSW 14 16818725 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CCTGAGGTGCTCTTAACTACAC -3'
(R):5'- AGATAGCCAGCAGTCTCTGAGC -3'

Sequencing Primer
(F):5'- GGTGCTCTTAACTACACACACATGAG -3'
(R):5'- TGAGCCTGTCTGATCACTAAACACTG -3'
Posted On2016-11-09