Incidental Mutation 'R5689:Olfr1512'
ID443592
Institutional Source Beutler Lab
Gene Symbol Olfr1512
Ensembl Gene ENSMUSG00000094140
Gene Nameolfactory receptor 1512
SynonymsGA_x6K02T2RJGY-622120-623061, MOR223-5
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52371332-52379168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52372757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 99 (V99M)
Ref Sequence ENSEMBL: ENSMUSP00000149717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071221] [ENSMUST00000214980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071221
AA Change: V99M

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071208
Gene: ENSMUSG00000094140
AA Change: V99M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.1e-48 PFAM
Pfam:7tm_1 41 290 2.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200261
Predicted Effect possibly damaging
Transcript: ENSMUST00000214980
AA Change: V99M

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Olfr1512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1512 APN 14 52372510 missense probably damaging 1.00
IGL01375:Olfr1512 APN 14 52372408 missense probably damaging 0.99
IGL02343:Olfr1512 APN 14 52372477 missense probably damaging 1.00
R1443:Olfr1512 UTSW 14 52372951 missense probably damaging 1.00
R1902:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R1903:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R3115:Olfr1512 UTSW 14 52372940 missense probably damaging 1.00
R4752:Olfr1512 UTSW 14 52372307 missense probably damaging 1.00
R5345:Olfr1512 UTSW 14 52372268 nonsense probably null
R6185:Olfr1512 UTSW 14 52372562 missense possibly damaging 0.91
R6287:Olfr1512 UTSW 14 52372291 missense probably damaging 1.00
R6757:Olfr1512 UTSW 14 52372715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTGGGACCACAGTAGG -3'
(R):5'- TACATCCTGACTCAGCTGGG -3'

Sequencing Primer
(F):5'- CCACAGTAGGGCAAGCG -3'
(R):5'- GGAACGCGCTCATCCTGATC -3'
Posted On2016-11-09