Incidental Mutation 'R5689:Lifr'
ID 443597
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Name LIF receptor alpha
Synonyms soluble differentiation-stimulating factor receptor, A230075M04Rik
MMRRC Submission 043322-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5689 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 7120095-7226970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7214285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 713 (Y713C)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
AlphaFold P42703
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: Y713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: Y713C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164529
AA Change: Y713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: Y713C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: Y713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: Y713C

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: Y713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226934
AA Change: Y713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227727
AA Change: Y713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8733 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 89,051,412 (GRCm39) C844F probably benign Het
Afdn T C 17: 14,075,621 (GRCm39) V945A probably damaging Het
Aimp2 T C 5: 143,843,389 (GRCm39) D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 (GRCm39) T115I probably benign Het
Atp11b G T 3: 35,888,501 (GRCm39) V924F possibly damaging Het
Atp8b1 C T 18: 64,697,608 (GRCm39) R412H probably damaging Het
Cfb T A 17: 35,080,770 (GRCm39) T76S probably benign Het
Cmpk2 A T 12: 26,519,766 (GRCm39) H139L probably benign Het
Cypt4 T C 9: 24,536,542 (GRCm39) S11P possibly damaging Het
Dbx1 A G 7: 49,282,519 (GRCm39) F229L probably damaging Het
Dnah6 T A 6: 72,998,210 (GRCm39) M4071L probably benign Het
Dnah7a A G 1: 53,444,857 (GRCm39) V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 (GRCm39) E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 (GRCm39) V263F probably damaging Het
Eno4 T A 19: 58,959,088 (GRCm39) D403E probably benign Het
Evi5l C T 8: 4,255,460 (GRCm39) Q542* probably null Het
Fam135a A G 1: 24,068,134 (GRCm39) S12P probably benign Het
Flnc G A 6: 29,441,591 (GRCm39) A458T probably benign Het
Fnip1 T C 11: 54,393,115 (GRCm39) V517A probably damaging Het
Galc G T 12: 98,179,245 (GRCm39) H361N possibly damaging Het
Gask1a T C 9: 121,794,754 (GRCm39) F303L probably damaging Het
Gcnt1 T A 19: 17,306,768 (GRCm39) D319V probably damaging Het
Gm26996 T C 6: 130,555,258 (GRCm39) noncoding transcript Het
Gm5321 A T 7: 6,022,268 (GRCm39) noncoding transcript Het
Grin3b T C 10: 79,810,465 (GRCm39) L657P probably damaging Het
Gstm5 T C 3: 107,803,981 (GRCm39) F54S probably damaging Het
Ilk C A 7: 105,390,857 (GRCm39) L267I probably benign Het
Lnx2 A T 5: 146,965,961 (GRCm39) V386E probably damaging Het
Lrch1 T C 14: 75,023,764 (GRCm39) E587G probably damaging Het
Or10g3 C T 14: 52,610,214 (GRCm39) V99M possibly damaging Het
Osgin1 A G 8: 120,171,728 (GRCm39) *173W probably null Het
Pcdhga7 C A 18: 37,849,736 (GRCm39) P581H probably damaging Het
Pde4dip A T 3: 97,599,683 (GRCm39) L2384* probably null Het
Phf12 T A 11: 77,914,551 (GRCm39) N115K probably damaging Het
Pmel A G 10: 128,552,170 (GRCm39) T335A probably damaging Het
Polr3e C A 7: 120,539,912 (GRCm39) T579K possibly damaging Het
Ptprc A G 1: 138,045,515 (GRCm39) V164A probably benign Het
Rapsn T C 2: 90,866,269 (GRCm39) F43S probably damaging Het
Rarb T A 14: 16,434,177 (GRCm38) I334F probably damaging Het
Rev3l T C 10: 39,670,954 (GRCm39) Y167H probably damaging Het
Rnf146 T C 10: 29,223,800 (GRCm39) T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,229,141 (GRCm39) probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc5a10 C T 11: 61,598,710 (GRCm39) M223I probably benign Het
Slc7a11 C G 3: 50,326,780 (GRCm39) V494L probably benign Het
Slitrk6 C T 14: 110,989,558 (GRCm39) E50K probably benign Het
Smg8 A G 11: 86,975,949 (GRCm39) F544S probably damaging Het
Tnpo3 T C 6: 29,571,063 (GRCm39) M444V possibly damaging Het
Trav7d-4 G A 14: 53,007,651 (GRCm39) R48H probably damaging Het
Trim50 A T 5: 135,382,516 (GRCm39) T123S probably damaging Het
Trpc4ap C G 2: 155,512,955 (GRCm39) probably null Het
Ttn T A 2: 76,618,620 (GRCm39) R14475S probably damaging Het
Uts2 A T 4: 151,083,565 (GRCm39) T59S possibly damaging Het
Vmn1r52 T C 6: 90,156,232 (GRCm39) S179P possibly damaging Het
Vmn2r116 A G 17: 23,616,693 (GRCm39) H537R probably benign Het
Vps16 C T 2: 130,281,011 (GRCm39) Q226* probably null Het
Zfhx2 T C 14: 55,311,360 (GRCm39) T445A possibly damaging Het
Zfp638 T C 6: 83,906,054 (GRCm39) V73A probably damaging Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7,215,220 (GRCm39) splice site probably null
IGL01470:Lifr APN 15 7,205,147 (GRCm39) nonsense probably null
IGL01489:Lifr APN 15 7,205,037 (GRCm39) splice site probably benign
IGL01619:Lifr APN 15 7,220,643 (GRCm39) missense probably damaging 1.00
IGL01636:Lifr APN 15 7,208,499 (GRCm39) splice site probably benign
IGL01943:Lifr APN 15 7,217,630 (GRCm39) missense probably damaging 1.00
IGL02253:Lifr APN 15 7,220,085 (GRCm39) missense probably damaging 1.00
IGL02355:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02362:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02450:Lifr APN 15 7,220,246 (GRCm39) missense probably damaging 1.00
IGL02477:Lifr APN 15 7,216,404 (GRCm39) missense probably damaging 1.00
IGL02503:Lifr APN 15 7,215,104 (GRCm39) missense probably damaging 1.00
IGL02571:Lifr APN 15 7,219,592 (GRCm39) unclassified probably benign
IGL03340:Lifr APN 15 7,207,417 (GRCm39) missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7,216,434 (GRCm39) missense possibly damaging 0.80
R0012:Lifr UTSW 15 7,205,089 (GRCm39) missense possibly damaging 0.78
R0015:Lifr UTSW 15 7,217,667 (GRCm39) splice site probably null
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0305:Lifr UTSW 15 7,206,982 (GRCm39) missense probably damaging 0.99
R0416:Lifr UTSW 15 7,196,395 (GRCm39) missense probably damaging 1.00
R0440:Lifr UTSW 15 7,186,672 (GRCm39) nonsense probably null
R0519:Lifr UTSW 15 7,207,061 (GRCm39) missense probably damaging 1.00
R0595:Lifr UTSW 15 7,206,950 (GRCm39) missense probably damaging 1.00
R0601:Lifr UTSW 15 7,198,753 (GRCm39) splice site probably null
R0780:Lifr UTSW 15 7,206,947 (GRCm39) missense probably benign 0.00
R0790:Lifr UTSW 15 7,215,196 (GRCm39) missense probably benign 0.13
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1400:Lifr UTSW 15 7,220,346 (GRCm39) missense probably benign 0.04
R1498:Lifr UTSW 15 7,220,099 (GRCm39) missense probably damaging 0.99
R1785:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1786:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1906:Lifr UTSW 15 7,217,612 (GRCm39) missense probably damaging 0.98
R2099:Lifr UTSW 15 7,186,732 (GRCm39) missense probably benign
R2102:Lifr UTSW 15 7,216,404 (GRCm39) missense probably damaging 1.00
R2136:Lifr UTSW 15 7,211,338 (GRCm39) missense possibly damaging 0.89
R2511:Lifr UTSW 15 7,196,397 (GRCm39) missense probably benign
R4375:Lifr UTSW 15 7,196,379 (GRCm39) missense probably benign
R4883:Lifr UTSW 15 7,215,106 (GRCm39) missense possibly damaging 0.94
R5681:Lifr UTSW 15 7,220,565 (GRCm39) missense probably damaging 1.00
R5693:Lifr UTSW 15 7,205,041 (GRCm39) missense probably damaging 1.00
R5902:Lifr UTSW 15 7,220,231 (GRCm39) missense probably benign
R5918:Lifr UTSW 15 7,188,897 (GRCm39) missense probably benign 0.00
R5924:Lifr UTSW 15 7,202,453 (GRCm39) missense probably benign 0.28
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6289:Lifr UTSW 15 7,196,391 (GRCm39) missense probably benign 0.00
R6339:Lifr UTSW 15 7,196,530 (GRCm39) missense probably benign 0.01
R6860:Lifr UTSW 15 7,202,418 (GRCm39) missense probably benign 0.02
R7106:Lifr UTSW 15 7,202,405 (GRCm39) missense probably benign 0.02
R7107:Lifr UTSW 15 7,208,421 (GRCm39) missense possibly damaging 0.88
R7274:Lifr UTSW 15 7,196,540 (GRCm39) critical splice donor site probably null
R7625:Lifr UTSW 15 7,198,723 (GRCm39) missense probably damaging 0.99
R7631:Lifr UTSW 15 7,214,258 (GRCm39) missense probably damaging 1.00
R7958:Lifr UTSW 15 7,211,478 (GRCm39) missense possibly damaging 0.62
R7991:Lifr UTSW 15 7,202,963 (GRCm39) missense possibly damaging 0.79
R8175:Lifr UTSW 15 7,216,496 (GRCm39) missense probably damaging 1.00
R8427:Lifr UTSW 15 7,220,462 (GRCm39) missense probably benign 0.01
R9274:Lifr UTSW 15 7,217,591 (GRCm39) missense probably damaging 0.98
R9311:Lifr UTSW 15 7,208,418 (GRCm39) missense possibly damaging 0.47
R9365:Lifr UTSW 15 7,198,521 (GRCm39) missense probably damaging 1.00
R9509:Lifr UTSW 15 7,188,955 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGGTTTGCTGAGTACTCC -3'
(R):5'- CTGTGAAATCAACAAGCAGGTG -3'

Sequencing Primer
(F):5'- GCTGAGTACTCCTAAATGTTTGC -3'
(R):5'- GTGGAGACAAGTGACTAACAATTTTG -3'
Posted On 2016-11-09