Incidental Mutation 'R5689:Vmn2r116'
ID443600
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Namevomeronasal 2, receptor 116
SynonymsV2Rp5, EG619697
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23384803-23401864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23397719 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 537 (H537R)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
Predicted Effect probably benign
Transcript: ENSMUST00000164856
AA Change: H537R

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: H537R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACACAGGATGTTATCAGGTTTTC -3'
(R):5'- AGGACATACTAAGTCACCGTATTCG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- GTCACCGTATTCGTATAATGACTAAC -3'
Posted On2016-11-09