Incidental Mutation 'R5689:Gcnt1'
ID443604
Institutional Source Beutler Lab
Gene Symbol Gcnt1
Ensembl Gene ENSMUSG00000038843
Gene Nameglucosaminyl (N-acetyl) transferase 1, core 2
SynonymsC2 GlcNAcT, 5630400D21Rik, IGnT, beta-1, 6-N-acetylglucosaminyltransferase
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location17326141-17356667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17329404 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 319 (D319V)
Ref Sequence ENSEMBL: ENSMUSP00000133935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169897] [ENSMUST00000174236]
PDB Structure
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) [X-RAY DIFFRACTION]
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) in complex with Galb1,3GalNAc [X-RAY DIFFRACTION]
Structure and mechanisim of core 2 beta1,6-n-acetylglucosaminyltransferase: a Metal-ion independent gt-a glycosyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000169897
AA Change: D319V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127835
Gene: ENSMUSG00000038843
AA Change: D319V

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
Pfam:Branch 123 392 9.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174137
Predicted Effect probably damaging
Transcript: ENSMUST00000174236
AA Change: D319V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133935
Gene: ENSMUSG00000038843
AA Change: D319V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Branch 127 396 5.7e-65 PFAM
Meta Mutation Damage Score 0.9670 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,6-N-acetylglucosaminyltransferase gene family. It is essential to the formation of Gal beta 1-3(GlcNAc beta 1-6)GalNAc structures and the core 2 O-glycan branch. The gene coding this enzyme was originally mapped to 9q21, but was later localized to 9q13. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele display a grossly normal phenotype and are fertile. There are abnormalities in white blood cell counts and in inflammatory response however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Gcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:Gcnt1 APN 19 17329416 missense probably damaging 1.00
IGL02836:Gcnt1 APN 19 17330129 missense probably benign
IGL02977:Gcnt1 APN 19 17329374 missense probably damaging 1.00
IGL03302:Gcnt1 APN 19 17329183 missense probably benign 0.25
magenta UTSW 19 17329404 missense probably damaging 1.00
Violet UTSW 19 17329359 missense probably damaging 1.00
R0183:Gcnt1 UTSW 19 17329117 missense probably benign 0.23
R0440:Gcnt1 UTSW 19 17330316 missense probably benign 0.00
R1159:Gcnt1 UTSW 19 17329804 missense possibly damaging 0.90
R1523:Gcnt1 UTSW 19 17329833 missense probably damaging 1.00
R2240:Gcnt1 UTSW 19 17329331 missense possibly damaging 0.91
R4510:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R4511:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R7765:Gcnt1 UTSW 19 17329359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTCACCAGCTCCGAAG -3'
(R):5'- TGCCTCCCAACAAGGAAGAG -3'

Sequencing Primer
(F):5'- ACAGAGCGCACGTGGACTC -3'
(R):5'- TACACCGTTGTCGATGGGAAGC -3'
Posted On2016-11-09