Incidental Mutation 'R5689:Eno4'
ID443605
Institutional Source Beutler Lab
Gene Symbol Eno4
Ensembl Gene ENSMUSG00000048029
Gene Nameenolase 4
Synonyms6430537H07Rik
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location58943425-58971421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58970656 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 403 (D403E)
Ref Sequence ENSEMBL: ENSMUSP00000144656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000054280] [ENSMUST00000163821] [ENSMUST00000200910] [ENSMUST00000202382]
Predicted Effect probably benign
Transcript: ENSMUST00000047511
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054280
AA Change: D591E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062584
Gene: ENSMUSG00000048029
AA Change: D591E

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 69 264 1.06e-20 SMART
Enolase_C 276 585 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163821
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200910
AA Change: D590E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144272
Gene: ENSMUSG00000048029
AA Change: D590E

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 68 263 1.06e-20 SMART
Enolase_C 275 584 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201123
Predicted Effect probably benign
Transcript: ENSMUST00000202382
AA Change: D403E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144656
Gene: ENSMUSG00000048029
AA Change: D403E

DomainStartEndE-ValueType
Blast:Enolase_N 1 88 1e-22 BLAST
Enolase_C 100 409 2.1e-45 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility associated with abnormal sperm morphology, number and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Eno4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Eno4 APN 19 58943545 missense possibly damaging 0.92
IGL02486:Eno4 APN 19 58945665 splice site probably null
IGL03087:Eno4 APN 19 58962816 missense possibly damaging 0.55
IGL03207:Eno4 APN 19 58953205 missense probably benign 0.04
R0048:Eno4 UTSW 19 58964538 missense possibly damaging 0.70
R0052:Eno4 UTSW 19 58968553 missense probably damaging 1.00
R0052:Eno4 UTSW 19 58968553 missense probably damaging 1.00
R0362:Eno4 UTSW 19 58943624 splice site probably benign
R2376:Eno4 UTSW 19 58953226 missense probably benign
R4387:Eno4 UTSW 19 58953208 missense probably benign 0.01
R4678:Eno4 UTSW 19 58946749 missense probably damaging 0.99
R4696:Eno4 UTSW 19 58945636 missense probably damaging 0.96
R4896:Eno4 UTSW 19 58964543 missense probably damaging 1.00
R4932:Eno4 UTSW 19 58964457 missense possibly damaging 0.82
R5050:Eno4 UTSW 19 58955496 missense probably benign 0.00
R5092:Eno4 UTSW 19 58945591 missense probably benign 0.02
R5104:Eno4 UTSW 19 58945541 missense probably benign 0.05
R5300:Eno4 UTSW 19 58955550 critical splice donor site probably null
R5450:Eno4 UTSW 19 58960247 missense possibly damaging 0.65
R5698:Eno4 UTSW 19 58968472 splice site probably null
R5874:Eno4 UTSW 19 58946806 missense probably benign
R6027:Eno4 UTSW 19 58946830 missense probably damaging 1.00
R6316:Eno4 UTSW 19 58960291 critical splice donor site probably null
R6494:Eno4 UTSW 19 58962794 missense probably damaging 1.00
R6706:Eno4 UTSW 19 58970680 missense probably benign 0.02
R7779:Eno4 UTSW 19 58968543 missense probably benign 0.19
R8169:Eno4 UTSW 19 58946652 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGAGCTCTGGATCCTTTTG -3'
(R):5'- CGAAAGCATGCACACGTTGG -3'

Sequencing Primer
(F):5'- ATCCTTTTGGGTCTGATGATCGTCAG -3'
(R):5'- TTACGGATATAAGTGGAGTTCAGAGC -3'
Posted On2016-11-09