Incidental Mutation 'R5690:Acadl'
ID443608
Institutional Source Beutler Lab
Gene Symbol Acadl
Ensembl Gene ENSMUSG00000026003
Gene Nameacyl-Coenzyme A dehydrogenase, long-chain
SynonymsLCAD, C79855
MMRRC Submission 043323-MU
Accession Numbers

Genbank: NM_007381.3; Ensembl: ENSMUST00000027153, ENSMUST00000139208

Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66830839-66863277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66853286 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 126 (Y126C)
Ref Sequence ENSEMBL: ENSMUSP00000027153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027153]
Predicted Effect probably damaging
Transcript: ENSMUST00000027153
AA Change: Y126C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027153
Gene: ENSMUSG00000026003
AA Change: Y126C

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 54 165 1.3e-33 PFAM
Pfam:Acyl-CoA_dh_M 169 266 9.2e-29 PFAM
Pfam:Acyl-CoA_dh_1 278 427 5.1e-44 PFAM
Pfam:Acyl-CoA_dh_2 293 416 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158795
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C12- and C16-acylCoA. In mice, deficiency of this gene can cause sudden death, cardiomyopathy as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutation of this gene results in reduced litter size, sudden death between 2-14 weeks of age, reduced serum glucose levels, lipid accumulation in the liver and heart, and cardiomyopathy. Heterozygous mutant animals exhibit reduced litter size. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Acadl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Acadl APN 1 66841705 missense probably damaging 0.97
IGL01983:Acadl APN 1 66841624 nonsense probably null
IGL02550:Acadl APN 1 66845166 critical splice donor site probably null
IGL02934:Acadl APN 1 66836975 missense probably benign 0.33
IGL03002:Acadl APN 1 66836969 missense probably benign 0.01
B6584:Acadl UTSW 1 66848473 splice site probably benign
PIT4377001:Acadl UTSW 1 66838405 missense probably damaging 1.00
R0426:Acadl UTSW 1 66841646 missense probably damaging 0.99
R0639:Acadl UTSW 1 66857408 missense probably benign
R1264:Acadl UTSW 1 66857553 missense probably benign 0.00
R1589:Acadl UTSW 1 66853223 missense probably benign 0.04
R2066:Acadl UTSW 1 66841746 splice site probably null
R3735:Acadl UTSW 1 66853289 missense probably benign 0.41
R4646:Acadl UTSW 1 66831443 missense probably benign 0.00
R6185:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7686:Acadl UTSW 1 66848398 critical splice donor site probably null
R7699:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7700:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7858:Acadl UTSW 1 66838324 missense probably benign 0.11
R7941:Acadl UTSW 1 66838324 missense probably benign 0.11
R8052:Acadl UTSW 1 66853178 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GAATCCAGAACCAGCTGAGG -3'
(R):5'- GCCCTGTTACTGTGTTAGAGCC -3'

Sequencing Primer
(F):5'- GAACCAGCTGAGGACATACC -3'
(R):5'- ACTGTGTTAGAGCCCACAATG -3'
Posted On2016-11-09