Incidental Mutation 'R5690:Tbx15'
ID 443615
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 043323-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R5690 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99216166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 76 (S76P)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: S76P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: S76P

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150756
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik A G 10: 70,759,144 (GRCm39) probably benign Het
Acadl T C 1: 66,892,445 (GRCm39) Y126C probably damaging Het
Ak6 A G 13: 100,792,129 (GRCm39) probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,066,233 (GRCm39) probably benign Het
Aqp7 G A 4: 41,035,510 (GRCm39) T115I probably benign Het
Atp6v1e1 A T 6: 120,785,317 (GRCm39) probably null Het
Axin1 A G 17: 26,413,911 (GRCm39) Y792C probably damaging Het
C1s2 T C 6: 124,607,996 (GRCm39) N233S probably benign Het
Ccer2 C A 7: 28,455,629 (GRCm39) probably benign Het
Cfap46 A G 7: 139,218,269 (GRCm39) S1481P probably benign Het
Cspg4 A T 9: 56,806,019 (GRCm39) T2277S probably benign Het
Ctsl T A 13: 64,513,022 (GRCm39) N300I probably damaging Het
Dnah2 T C 11: 69,382,370 (GRCm39) I1247V probably benign Het
Dsg3 A T 18: 20,655,108 (GRCm39) Q135L probably benign Het
Efcab14 G A 4: 115,617,244 (GRCm39) V318M possibly damaging Het
Etl4 G A 2: 20,810,647 (GRCm39) S910N probably benign Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Frmd4b T C 6: 97,330,164 (GRCm39) E133G possibly damaging Het
Herc2 T C 7: 55,807,453 (GRCm39) F2514S probably benign Het
Il18rap A G 1: 40,576,272 (GRCm39) D261G possibly damaging Het
Klk1b16 A G 7: 43,790,318 (GRCm39) probably null Het
Lrp1b A C 2: 40,640,906 (GRCm39) probably null Het
Mrpl45 C A 11: 97,212,412 (GRCm39) probably benign Het
Myh13 A G 11: 67,220,101 (GRCm39) E150G probably damaging Het
Nbas T A 12: 13,386,285 (GRCm39) V737D probably damaging Het
Ncr1 T C 7: 4,341,296 (GRCm39) Y59H probably damaging Het
Nt5c1a T A 4: 123,109,732 (GRCm39) V277E probably damaging Het
Ogfod1 T A 8: 94,784,769 (GRCm39) S343T probably damaging Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pcdhb18 G A 18: 37,623,537 (GRCm39) R289Q probably benign Het
Pnpla1 A T 17: 29,097,346 (GRCm39) I171F probably damaging Het
Rab5if G A 2: 156,707,234 (GRCm39) V58I probably benign Het
Rdh8 A G 9: 20,736,785 (GRCm39) N259S probably damaging Het
Resf1 T C 6: 149,229,735 (GRCm39) L927S possibly damaging Het
Slc22a12 A G 19: 6,586,878 (GRCm39) M496T probably benign Het
Slc8b1 G A 5: 120,651,270 (GRCm39) W10* probably null Het
Smarcc2 G A 10: 128,320,276 (GRCm39) G887S probably damaging Het
Smc1b A G 15: 84,996,974 (GRCm39) S549P probably damaging Het
Synj2 A G 17: 6,085,802 (GRCm39) M1181V probably benign Het
Tbx2 A T 11: 85,727,879 (GRCm39) I271F probably damaging Het
Thap4 A G 1: 93,644,352 (GRCm39) probably null Het
Tmc2 A G 2: 130,074,306 (GRCm39) Y333C probably damaging Het
Trcg1 C T 9: 57,149,094 (GRCm39) P222L probably benign Het
Tubb3 T C 8: 124,148,045 (GRCm39) V326A probably benign Het
Unc80 A C 1: 66,679,731 (GRCm39) I2101L probably benign Het
Vmn1r19 T C 6: 57,381,780 (GRCm39) L111S probably benign Het
Vps16 C T 2: 130,281,011 (GRCm39) Q226* probably null Het
Xpo4 T C 14: 57,828,446 (GRCm39) I805V probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATGTCATCATGTTGGACAC -3'
(R):5'- TCTGTTCCGATATCATGGAACC -3'

Sequencing Primer
(F):5'- TGTTGGACACATGAAACCTGAAAG -3'
(R):5'- CTCTTCCAGAGGTCAGCACATTG -3'
Posted On 2016-11-09