Incidental Mutation 'R5690:Efcab14'
ID443618
Institutional Source Beutler Lab
Gene Symbol Efcab14
Ensembl Gene ENSMUSG00000034210
Gene NameEF-hand calcium binding domain 14
Synonyms
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115737744-115777327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115760047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 318 (V318M)
Ref Sequence ENSEMBL: ENSMUSP00000074025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074425] [ENSMUST00000106522] [ENSMUST00000106524] [ENSMUST00000106525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074425
AA Change: V318M

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074025
Gene: ENSMUSG00000034210
AA Change: V318M

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1fi6a_ 425 498 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106522
AA Change: V318M

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102132
Gene: ENSMUSG00000034210
AA Change: V318M

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106524
SMART Domains Protein: ENSMUSP00000102134
Gene: ENSMUSG00000034210

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 360 418 3e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106525
AA Change: V318M

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102135
Gene: ENSMUSG00000034210
AA Change: V318M

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 424 482 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136593
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Efcab14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Efcab14 APN 4 115760064 splice site probably benign
IGL02300:Efcab14 APN 4 115758896 critical splice donor site probably null
IGL02598:Efcab14 APN 4 115740434 nonsense probably null
IGL02680:Efcab14 APN 4 115740418 missense probably damaging 1.00
IGL03066:Efcab14 APN 4 115738804 missense probably benign 0.12
R0123:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R0134:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R1275:Efcab14 UTSW 4 115756473 missense probably damaging 1.00
R1481:Efcab14 UTSW 4 115756517 missense probably benign 0.07
R1590:Efcab14 UTSW 4 115756549 splice site probably benign
R1694:Efcab14 UTSW 4 115746539 missense possibly damaging 0.82
R1768:Efcab14 UTSW 4 115752919 critical splice acceptor site probably null
R1769:Efcab14 UTSW 4 115752991 missense probably damaging 1.00
R3887:Efcab14 UTSW 4 115738660 start codon destroyed probably null 1.00
R4158:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R4160:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R5584:Efcab14 UTSW 4 115764597 missense possibly damaging 0.49
R5796:Efcab14 UTSW 4 115746583 missense probably damaging 0.99
R5945:Efcab14 UTSW 4 115756467 missense probably damaging 1.00
R6445:Efcab14 UTSW 4 115756471 missense possibly damaging 0.74
R6761:Efcab14 UTSW 4 115738827 missense probably damaging 1.00
R7564:Efcab14 UTSW 4 115759962 missense probably benign 0.33
R8030:Efcab14 UTSW 4 115766402 missense probably benign 0.07
X0018:Efcab14 UTSW 4 115766486 missense probably damaging 0.99
Z1177:Efcab14 UTSW 4 115738702 missense probably damaging 1.00
Predicted Primers
Posted On2016-11-09