Incidental Mutation 'R5690:Vmn1r19'
ID443621
Institutional Source Beutler Lab
Gene Symbol Vmn1r19
Ensembl Gene ENSMUSG00000115799
Gene Namevomeronasal 1 receptor 19
SynonymsV1rc27
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57403780-57406034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57404795 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 111 (L111S)
Ref Sequence ENSEMBL: ENSMUSP00000087264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089830]
Predicted Effect probably benign
Transcript: ENSMUST00000089830
AA Change: L111S

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087264
Gene: ENSMUSG00000115799
AA Change: L111S

DomainStartEndE-ValueType
Pfam:V1R 28 293 6.6e-58 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Vmn1r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn1r19 APN 6 57405262 missense probably benign 0.03
IGL01287:Vmn1r19 APN 6 57405194 missense probably damaging 1.00
IGL01516:Vmn1r19 APN 6 57404872 missense probably benign 0.03
IGL01895:Vmn1r19 APN 6 57405260 missense probably benign 0.02
IGL02676:Vmn1r19 APN 6 57405040 missense possibly damaging 0.94
IGL03040:Vmn1r19 APN 6 57405362 missense unknown
IGL03087:Vmn1r19 APN 6 57404491 missense probably benign 0.01
PIT4802001:Vmn1r19 UTSW 6 57405052 missense probably damaging 1.00
R0319:Vmn1r19 UTSW 6 57404615 missense possibly damaging 0.93
R1368:Vmn1r19 UTSW 6 57404671 missense probably benign 0.01
R1997:Vmn1r19 UTSW 6 57405048 missense probably damaging 1.00
R2920:Vmn1r19 UTSW 6 57404924 missense probably benign 0.03
R3857:Vmn1r19 UTSW 6 57405113 missense possibly damaging 0.68
R4090:Vmn1r19 UTSW 6 57404735 missense probably damaging 1.00
R4547:Vmn1r19 UTSW 6 57404789 missense possibly damaging 0.56
R4823:Vmn1r19 UTSW 6 57405234 nonsense probably null
R4951:Vmn1r19 UTSW 6 57404942 missense probably benign 0.36
R5077:Vmn1r19 UTSW 6 57405041 missense probably benign 0.00
R5459:Vmn1r19 UTSW 6 57404490 nonsense probably null
R5625:Vmn1r19 UTSW 6 57405296 missense probably damaging 1.00
R5761:Vmn1r19 UTSW 6 57405353 missense unknown
R6124:Vmn1r19 UTSW 6 57404617 missense probably benign 0.02
R6373:Vmn1r19 UTSW 6 57405332 missense unknown
R6476:Vmn1r19 UTSW 6 57404593 missense probably damaging 0.99
R6938:Vmn1r19 UTSW 6 57405007 missense possibly damaging 0.94
R7027:Vmn1r19 UTSW 6 57404490 nonsense probably null
R7359:Vmn1r19 UTSW 6 57405095 missense probably damaging 0.99
R7568:Vmn1r19 UTSW 6 57404828 missense possibly damaging 0.69
R7893:Vmn1r19 UTSW 6 57404679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGATCTCCTGTCAACTGAC -3'
(R):5'- CCCCTGATGATGTAGTTCATGGG -3'

Sequencing Primer
(F):5'- CACATAATGATGATCCTCAGTGAAGG -3'
(R):5'- CTGATGATGTAGTTCATGGGAAAGAG -3'
Posted On2016-11-09