Incidental Mutation 'R5690:Ncr1'
ID443625
Institutional Source Beutler Lab
Gene Symbol Ncr1
Ensembl Gene ENSMUSG00000062524
Gene Namenatural cytotoxicity triggering receptor 1
SynonymsNKp46, MAR1 (mouse activating receptor 1), Ly94
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4337724-4345164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4338297 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 59 (Y59H)
Ref Sequence ENSEMBL: ENSMUSP00000145847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006792] [ENSMUST00000126417]
Predicted Effect probably damaging
Transcript: ENSMUST00000006792
AA Change: Y96H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006792
Gene: ENSMUSG00000062524
AA Change: Y96H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 34 118 5.21e-2 SMART
IG 129 211 1.49e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126417
AA Change: Y59H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene lead to alterations in susceptibility to viral infection induced morbidity/mortality, NK cell number, NK cell cytolysis, and T cell responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Ncr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ncr1 APN 7 4341288 missense possibly damaging 0.50
IGL01994:Ncr1 APN 7 4341254 missense probably benign 0.16
IGL02163:Ncr1 APN 7 4341263 missense possibly damaging 0.86
IGL02610:Ncr1 APN 7 4338133 missense probably benign 0.42
IGL02885:Ncr1 APN 7 4338226 missense probably damaging 1.00
IGL03082:Ncr1 APN 7 4341242 splice site probably benign
R0196:Ncr1 UTSW 7 4340973 missense probably damaging 1.00
R1172:Ncr1 UTSW 7 4338121 missense probably benign 0.19
R1758:Ncr1 UTSW 7 4340808 missense probably benign 0.40
R2065:Ncr1 UTSW 7 4338207 missense probably benign 0.00
R2135:Ncr1 UTSW 7 4340757 splice site probably benign
R2397:Ncr1 UTSW 7 4338261 missense probably benign 0.22
R5389:Ncr1 UTSW 7 4340933 missense probably benign 0.01
R5648:Ncr1 UTSW 7 4344520 missense probably damaging 0.97
R5817:Ncr1 UTSW 7 4340895 missense possibly damaging 0.59
R5847:Ncr1 UTSW 7 4344574 missense probably benign 0.04
R7033:Ncr1 UTSW 7 4338145 missense possibly damaging 0.59
R7391:Ncr1 UTSW 7 4344471 missense possibly damaging 0.86
R7395:Ncr1 UTSW 7 4338151 missense probably damaging 1.00
R7680:Ncr1 UTSW 7 4338124 missense possibly damaging 0.52
R8163:Ncr1 UTSW 7 4340829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCAGAGACTCTCCCGAAAC -3'
(R):5'- TAAGGAGTGTCTGAGTGCGAC -3'

Sequencing Primer
(F):5'- CAGCATCATGGTCACAAATGG -3'
(R):5'- GAGTGCGACTTAGATAATTTTCAGC -3'
Posted On2016-11-09