Incidental Mutation 'R5690:Tubb3'
ID443631
Institutional Source Beutler Lab
Gene Symbol Tubb3
Ensembl Gene ENSMUSG00000062380
Gene Nametubulin, beta 3 class III
SynonymsbetaIII-tubulin, 3200002H15Rik
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123411424-123422015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123421306 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 326 (V326A)
Ref Sequence ENSEMBL: ENSMUSP00000071134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000127664] [ENSMUST00000212743] [ENSMUST00000212883]
Predicted Effect probably benign
Transcript: ENSMUST00000071134
AA Change: V326A

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380
AA Change: V326A

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit neonatal lethality associated with respiratory distress, abnormal corpus callosum morphology, abnormal cranial nerves, and defective axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Tubb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Tubb3 APN 8 123420966 missense probably benign 0.20
IGL02208:Tubb3 APN 8 123420864 missense probably damaging 1.00
IGL02253:Tubb3 APN 8 123420820 missense probably benign 0.17
IGL02669:Tubb3 APN 8 123421117 missense probably damaging 0.98
F5770:Tubb3 UTSW 8 123411675 splice site probably benign
PIT4810001:Tubb3 UTSW 8 123421657 missense possibly damaging 0.72
R1164:Tubb3 UTSW 8 123421447 missense probably damaging 1.00
R2074:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R2075:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R2091:Tubb3 UTSW 8 123421678 splice site probably null
R3012:Tubb3 UTSW 8 123421236 missense probably damaging 1.00
R3913:Tubb3 UTSW 8 123421009 missense possibly damaging 0.94
R3951:Tubb3 UTSW 8 123421264 missense probably damaging 0.99
R4609:Tubb3 UTSW 8 123420919 missense probably damaging 1.00
R5054:Tubb3 UTSW 8 123420868 missense probably damaging 0.99
R5256:Tubb3 UTSW 8 123421652 missense probably benign
R7638:Tubb3 UTSW 8 123421161 missense probably benign 0.04
R8263:Tubb3 UTSW 8 123421129 missense possibly damaging 0.90
R8320:Tubb3 UTSW 8 123420855 missense possibly damaging 0.80
Z1088:Tubb3 UTSW 8 123421534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCTGGCTGTGAACATGG -3'
(R):5'- AACTGCTCCGAGATGCGTTTG -3'

Sequencing Primer
(F):5'- TGAACATGGTGCCGTTCC -3'
(R):5'- AGATGCGTTTGAACAGCTCC -3'
Posted On2016-11-09