Incidental Mutation 'R5690:Otogl'
ID443637
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to A at 107777117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341] [ENSMUST00000165341]
Predicted Effect silent
Transcript: ENSMUST00000165341
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Predicted Effect silent
Transcript: ENSMUST00000165341
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
R7864:Otogl UTSW 10 107869567 missense probably damaging 1.00
R7879:Otogl UTSW 10 107777109 missense probably benign 0.00
R7956:Otogl UTSW 10 107878026 missense possibly damaging 0.62
R7988:Otogl UTSW 10 107895776 missense probably damaging 1.00
R8057:Otogl UTSW 10 107808615 missense probably benign 0.00
R8058:Otogl UTSW 10 107762426 missense probably damaging 1.00
R8127:Otogl UTSW 10 107895752 missense probably damaging 1.00
R8143:Otogl UTSW 10 107806666 missense probably damaging 1.00
R8310:Otogl UTSW 10 107777600 missense possibly damaging 0.94
R8319:Otogl UTSW 10 107853266 critical splice donor site probably null
R8339:Otogl UTSW 10 107789535 missense probably damaging 0.99
R8339:Otogl UTSW 10 107789536 missense probably benign 0.34
R8394:Otogl UTSW 10 107886465 critical splice donor site probably null
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Z1176:Otogl UTSW 10 107777213 missense probably benign
Z1176:Otogl UTSW 10 107778873 missense probably damaging 0.97
Z1176:Otogl UTSW 10 107789032 missense probably benign 0.00
Z1177:Otogl UTSW 10 107763258 nonsense probably null
Z1177:Otogl UTSW 10 107853397 missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107876903 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCTGCTTCATTTTAAGGACAGTC -3'
(R):5'- CACCATCACTTGAGTGTGCAAAAG -3'

Sequencing Primer
(F):5'- ATTGGCCTGAACTCACCATGTAG -3'
(R):5'- CTTGAGTGTGCAAAAGATATGAACC -3'
Posted On2016-11-09