Incidental Mutation 'R5690:Ctsl'
ID443644
Institutional Source Beutler Lab
Gene Symbol Ctsl
Ensembl Gene ENSMUSG00000021477
Gene Namecathepsin L
Synonymsmajor excreted protein, 1190035F06Rik, Cat L, MEP
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location64359337-64370890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64365208 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 300 (N300I)
Ref Sequence ENSEMBL: ENSMUSP00000152169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021933] [ENSMUST00000220737] [ENSMUST00000222462] [ENSMUST00000222517] [ENSMUST00000223494]
Predicted Effect probably damaging
Transcript: ENSMUST00000021933
AA Change: N300I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021933
Gene: ENSMUSG00000021477
AA Change: N300I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.98e-23 SMART
Pept_C1 114 332 1.67e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220617
Predicted Effect probably benign
Transcript: ENSMUST00000220737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221966
Predicted Effect probably benign
Transcript: ENSMUST00000222462
Predicted Effect probably damaging
Transcript: ENSMUST00000222517
AA Change: N300I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000222971
AA Change: N155I
Predicted Effect probably benign
Transcript: ENSMUST00000223494
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the activation peptide and the cathepsin L1 heavy and light chains. The mature enzyme appears to be important in embryonic development through its processing of histone H3 and may play a role in disease progression in a model of kidney disease. Homozygous knockout mice for this gene exhibit hair loss, skin thickening, bone and heart defects, and enhanced susceptibility to bacterial infection. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for mutant alleles may show partial or complete hair-loss, skin defects, impaired T cell maturation, dilated cardiomyopathy, and high postnatal mortality. Mutant males for some alleles show both normal and atrophic seminiferous tubules and reduced sperm production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Ctsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ctsl APN 13 64368168 missense probably damaging 1.00
IGL02895:Ctsl APN 13 64366512 missense probably damaging 0.97
mauvais UTSW 13 64364102 unclassified probably null
patch UTSW 13 64366623 nonsense probably null
R0518:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R0521:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R1546:Ctsl UTSW 13 64367879 missense probably damaging 1.00
R2096:Ctsl UTSW 13 64369026 critical splice donor site probably null
R5804:Ctsl UTSW 13 64366488 missense probably damaging 1.00
R6182:Ctsl UTSW 13 64367972 missense probably damaging 0.99
R6670:Ctsl UTSW 13 64364102 unclassified probably null
R6725:Ctsl UTSW 13 64366623 nonsense probably null
R6886:Ctsl UTSW 13 64365147 utr 3 prime probably null
R7502:Ctsl UTSW 13 64367068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTCTCCCCAACAAGCTTAC -3'
(R):5'- GGGATCTGTGAAGCTACAGAATTTTG -3'

Sequencing Primer
(F):5'- AGGTCTCCCCAACAAGCTTACTTTAG -3'
(R):5'- GCTACAGAATTTTGAGATACAGTCC -3'
Posted On2016-11-09