Incidental Mutation 'R5690:Ak6'
ID443645
Institutional Source Beutler Lab
Gene Symbol Ak6
Ensembl Gene ENSMUSG00000078941
Gene Nameadenylate kinase 6
Synonyms2810046E22Rik, 4921516M08Rik
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5690 (G1)
Quality Score187
Status Not validated
Chromosome13
Chromosomal Location100650979-100666359 bp(+) (GRCm38)
Type of Mutationunclassified (26 bp from exon)
DNA Base Change (assembly) A to G at 100655621 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022135] [ENSMUST00000022136] [ENSMUST00000084721] [ENSMUST00000167256] [ENSMUST00000177848] [ENSMUST00000185767] [ENSMUST00000187792] [ENSMUST00000190165] [ENSMUST00000190594] [ENSMUST00000190729] [ENSMUST00000226050]
Predicted Effect probably benign
Transcript: ENSMUST00000022135
SMART Domains Protein: ENSMUSP00000022135
Gene: ENSMUSG00000078941

DomainStartEndE-ValueType
Pfam:AAA_17 5 113 1.1e-13 PFAM
Pfam:AAA 6 45 3.6e-6 PFAM
Pfam:AAA_18 6 126 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022136
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084721
AA Change: M191V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081772
Gene: ENSMUSG00000078941
AA Change: M191V

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167256
AA Change: M191V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132143
Gene: ENSMUSG00000052293
AA Change: M191V

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 9 129 1.4e-52 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177848
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185767
SMART Domains Protein: ENSMUSP00000140423
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 2.2e-62 PFAM
Pfam:Bromo_TP 12 77 7.6e-5 PFAM
Pfam:CENP-S 15 80 5.7e-7 PFAM
Pfam:Histone 16 78 1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185901
Predicted Effect probably null
Transcript: ENSMUST00000187792
SMART Domains Protein: ENSMUSP00000140051
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3e-62 PFAM
Pfam:CENP-S 15 80 6.9e-7 PFAM
Pfam:Histone 16 78 1.3e-4 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190165
SMART Domains Protein: ENSMUSP00000139407
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3.8e-62 PFAM
Pfam:CENP-S 15 80 7.9e-7 PFAM
Pfam:Histone 16 78 1.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190210
Predicted Effect probably benign
Transcript: ENSMUST00000190594
AA Change: M191V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140244
Gene: ENSMUSG00000052293
AA Change: M191V

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190729
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Ak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ak6 APN 13 100664091 missense probably benign 0.05
PIT4151001:Ak6 UTSW 13 100655095 missense probably damaging 0.98
R0189:Ak6 UTSW 13 100655142 missense probably damaging 1.00
R1716:Ak6 UTSW 13 100655669 missense probably benign
R1736:Ak6 UTSW 13 100655181 unclassified probably null
R4351:Ak6 UTSW 13 100655603 nonsense probably null
R4625:Ak6 UTSW 13 100655673 missense probably benign 0.00
R5711:Ak6 UTSW 13 100654214 missense probably damaging 0.97
R5870:Ak6 UTSW 13 100655424 missense probably damaging 1.00
R6018:Ak6 UTSW 13 100665951 nonsense probably null
R6386:Ak6 UTSW 13 100655803 unclassified probably benign
R7524:Ak6 UTSW 13 100663907 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAACTGCCCCAAACTATAGGC -3'
(R):5'- CAGGTTACATGCATCGTGGC -3'

Sequencing Primer
(F):5'- GTCTTTACAGAAAAAGGCACCTG -3'
(R):5'- TACATGCATCGTGGCTAGAC -3'
Posted On2016-11-09