Incidental Mutation 'R5690:Xpo4'
ID443646
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Nameexportin 4
Synonyms
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57577521-57665430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57590989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 805 (I805V)
Ref Sequence ENSEMBL: ENSMUSP00000086909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174545]
Predicted Effect probably benign
Transcript: ENSMUST00000089482
AA Change: I805V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: I805V

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174545
AA Change: I805V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: I805V

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57604398 missense probably benign
IGL02537:Xpo4 APN 14 57593833 missense probably benign
IGL02554:Xpo4 APN 14 57590088 missense probably benign 0.00
IGL02826:Xpo4 APN 14 57629420 missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57618228 missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57584611 missense probably null 0.98
R0245:Xpo4 UTSW 14 57630240 missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57613274 missense probably benign 0.07
R0606:Xpo4 UTSW 14 57638208 unclassified probably benign
R0761:Xpo4 UTSW 14 57613383 missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57603672 missense probably benign
R1853:Xpo4 UTSW 14 57585907 missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57590871 missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57586644 missense probably null 0.19
R2035:Xpo4 UTSW 14 57585926 missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57590090 missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57629503 missense probably benign 0.00
R2937:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R2938:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R4066:Xpo4 UTSW 14 57588054 missense probably benign 0.07
R4086:Xpo4 UTSW 14 57643033 intron probably benign
R4373:Xpo4 UTSW 14 57591022 nonsense probably null
R4620:Xpo4 UTSW 14 57630325 missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57590108 missense probably benign 0.01
R4755:Xpo4 UTSW 14 57618181 missense probably benign 0.01
R4831:Xpo4 UTSW 14 57590102 missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57638289 missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57638240 missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57584641 missense probably benign 0.02
R5279:Xpo4 UTSW 14 57613409 missense probably benign 0.37
R5375:Xpo4 UTSW 14 57638307 missense probably damaging 0.99
R5936:Xpo4 UTSW 14 57643499 missense probably benign
R6393:Xpo4 UTSW 14 57638313 missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57613403 missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57582310 missense probably benign
R6923:Xpo4 UTSW 14 57603711 missense probably benign 0.19
R7028:Xpo4 UTSW 14 57597051 missense probably benign 0.22
R7442:Xpo4 UTSW 14 57630223 missense probably benign 0.00
R7469:Xpo4 UTSW 14 57597979 missense probably benign
R7490:Xpo4 UTSW 14 57602621 frame shift probably null
R7622:Xpo4 UTSW 14 57597011 missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57589959 missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57613349 missense probably benign 0.00
R7895:Xpo4 UTSW 14 57602591 missense probably benign 0.03
R8000:Xpo4 UTSW 14 57589946 missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57597884 critical splice donor site probably null
R8395:Xpo4 UTSW 14 57648467 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTCAGAGATTTGTAATCCTGACAG -3'
(R):5'- CAAATAGTCCTTGTTTTGTGTGCTC -3'

Sequencing Primer
(F):5'- CTTACCTCTCCAAGATAGCATATTTG -3'
(R):5'- TCCTTCTGCCCCAGTGAGAG -3'
Posted On2016-11-09