Incidental Mutation 'R5690:Fetub'
ID443650
Institutional Source Beutler Lab
Gene Symbol Fetub
Ensembl Gene ENSMUSG00000022871
Gene Namefetuin beta
Synonyms2310011O17Rik, D17980
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22918334-22939778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22932331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 143 (R143C)
Ref Sequence ENSEMBL: ENSMUSP00000155898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023587] [ENSMUST00000116625] [ENSMUST00000167399] [ENSMUST00000170805] [ENSMUST00000231768] [ENSMUST00000231880] [ENSMUST00000232097]
Predicted Effect probably damaging
Transcript: ENSMUST00000023587
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023587
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116625
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112324
Gene: ENSMUSG00000022871
AA Change: R63C

DomainStartEndE-ValueType
Blast:CY 1 61 4e-33 BLAST
CY 73 175 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167399
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128745
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170805
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128989
Gene: ENSMUSG00000022871
AA Change: R143C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231768
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231880
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232097
AA Change: R143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2607 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility due to premature hardening of the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Fetub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Fetub APN 16 22935696 missense probably benign 0.29
IGL00843:Fetub APN 16 22929629 splice site probably benign
IGL01450:Fetub APN 16 22929236 missense probably benign 0.01
IGL01522:Fetub APN 16 22929641 start codon destroyed probably null 0.10
IGL02222:Fetub APN 16 22932328 missense probably damaging 1.00
IGL02745:Fetub APN 16 22937926 missense probably damaging 0.99
R0062:Fetub UTSW 16 22929086 intron probably benign
R0310:Fetub UTSW 16 22929756 splice site probably benign
R0508:Fetub UTSW 16 22929295 missense probably benign 0.01
R0604:Fetub UTSW 16 22935660 missense possibly damaging 0.78
R1560:Fetub UTSW 16 22939367 missense probably benign 0.00
R1844:Fetub UTSW 16 22935669 missense possibly damaging 0.94
R1896:Fetub UTSW 16 22932295 missense probably damaging 1.00
R3716:Fetub UTSW 16 22935693 missense probably damaging 1.00
R3717:Fetub UTSW 16 22935693 missense probably damaging 1.00
R4274:Fetub UTSW 16 22935679 missense probably damaging 1.00
R4751:Fetub UTSW 16 22937895 missense probably benign 0.02
R4941:Fetub UTSW 16 22937874 missense probably benign 0.01
R5468:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5470:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5692:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5781:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6193:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6195:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6244:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6245:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6273:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6274:Fetub UTSW 16 22932331 missense probably damaging 1.00
R7134:Fetub UTSW 16 22929257 missense possibly damaging 0.54
R7698:Fetub UTSW 16 22939309 missense probably benign 0.31
R7969:Fetub UTSW 16 22929699 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATGCTAAAGAGTTCTCCCCAC -3'
(R):5'- TGACTTAGGAAGGCTGTCCC -3'

Sequencing Primer
(F):5'- ACACAGAACTGGATTTAAGTTTCAC -3'
(R):5'- TGTCCCCTGGGAGGAGAAGTATG -3'
Posted On2016-11-09