Incidental Mutation 'R5690:Pcdhb18'
ID443654
Institutional Source Beutler Lab
Gene Symbol Pcdhb18
Ensembl Gene ENSMUSG00000048347
Gene Nameprotocadherin beta 18
SynonymsPcdhbR, Pcdhb9
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37489465-37494505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37490484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 289 (R289Q)
Ref Sequence ENSEMBL: ENSMUSP00000052113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
AA Change: R289Q

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347
AA Change: R289Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Pcdhb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhb18 APN 18 37491931 missense probably benign 0.35
IGL02651:Pcdhb18 APN 18 37491181 nonsense probably null
IGL02721:Pcdhb18 APN 18 37490031 missense probably benign 0.33
IGL02945:Pcdhb18 APN 18 37489995 missense probably benign 0.34
IGL03030:Pcdhb18 APN 18 37490733 missense probably damaging 1.00
IGL03346:Pcdhb18 APN 18 37489621 start codon destroyed probably null 0.99
R0206:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0208:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0680:Pcdhb18 UTSW 18 37490294 missense probably damaging 0.98
R1517:Pcdhb18 UTSW 18 37489620 start codon destroyed probably null 1.00
R1519:Pcdhb18 UTSW 18 37490892 missense probably damaging 1.00
R1597:Pcdhb18 UTSW 18 37491767 missense probably benign 0.19
R1735:Pcdhb18 UTSW 18 37490769 missense probably benign 0.00
R2089:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2206:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R2207:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R4773:Pcdhb18 UTSW 18 37490454 missense probably damaging 1.00
R4837:Pcdhb18 UTSW 18 37489814 missense probably damaging 1.00
R5271:Pcdhb18 UTSW 18 37491596 missense possibly damaging 0.94
R5568:Pcdhb18 UTSW 18 37491800 missense probably benign 0.44
R5647:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5648:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5692:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5812:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5813:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5928:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5929:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5930:Pcdhb18 UTSW 18 37491935 missense possibly damaging 0.63
R6209:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6255:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6602:Pcdhb18 UTSW 18 37490480 missense probably damaging 0.99
R6699:Pcdhb18 UTSW 18 37491952 missense probably benign 0.00
R7055:Pcdhb18 UTSW 18 37490811 missense possibly damaging 0.64
R7197:Pcdhb18 UTSW 18 37490383 missense probably benign 0.06
R7289:Pcdhb18 UTSW 18 37490647 missense probably damaging 1.00
R7345:Pcdhb18 UTSW 18 37491923 missense probably benign 0.19
R7403:Pcdhb18 UTSW 18 37491897 missense probably benign 0.09
R7541:Pcdhb18 UTSW 18 37491609 missense probably damaging 1.00
R7651:Pcdhb18 UTSW 18 37490993 missense probably benign 0.00
R7670:Pcdhb18 UTSW 18 37491696 missense probably damaging 1.00
R7673:Pcdhb18 UTSW 18 37491737 missense probably benign 0.39
R7783:Pcdhb18 UTSW 18 37489821 missense probably benign 0.01
R7819:Pcdhb18 UTSW 18 37491255 missense possibly damaging 0.60
R7826:Pcdhb18 UTSW 18 37490942 missense probably damaging 0.98
R7857:Pcdhb18 UTSW 18 37491311 missense probably benign
R7866:Pcdhb18 UTSW 18 37490459 missense probably damaging 0.99
R7895:Pcdhb18 UTSW 18 37490467 missense probably benign 0.27
X0022:Pcdhb18 UTSW 18 37490273 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTTTGGACATCAATGATAATGCCC -3'
(R):5'- GCACGGTTTCAGGTGAGTTC -3'

Sequencing Primer
(F):5'- TCAATGATAATGCCCCACAGTTTC -3'
(R):5'- CGGTTTCAGGTGAGTTCTCAACAAC -3'
Posted On2016-11-09