Incidental Mutation 'R5691:Tmc7'
ID443688
Institutional Source Beutler Lab
Gene Symbol Tmc7
Ensembl Gene ENSMUSG00000042246
Gene Nametransmembrane channel-like gene family 7
Synonyms
MMRRC Submission 043324-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5691 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118535841-118584736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118541893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 672 (I672V)
Ref Sequence ENSEMBL: ENSMUSP00000046927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044195]
Predicted Effect probably benign
Transcript: ENSMUST00000044195
AA Change: I672V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046927
Gene: ENSMUSG00000042246
AA Change: I672V

DomainStartEndE-ValueType
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 216 238 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 402 424 N/A INTRINSIC
Pfam:TMC 484 595 5.2e-51 PFAM
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153635
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410022M11Rik A G 14: 56,812,373 probably benign Het
Abcb5 A T 12: 118,927,235 M509K probably damaging Het
Ap4m1 A G 5: 138,172,391 Y34C probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Bcl10 C T 3: 145,933,149 T182I probably benign Het
Cdc123 T A 2: 5,823,175 N87I probably benign Het
Cfap46 T C 7: 139,606,700 E2431G possibly damaging Het
Dcc T C 18: 71,575,083 T521A probably damaging Het
Defb46 T A 8: 19,242,133 I55K probably benign Het
Dlgap4 A G 2: 156,704,470 T353A probably benign Het
Eqtn C A 4: 94,923,728 probably null Het
Ermn A T 2: 58,047,764 M279K probably damaging Het
Fan1 C A 7: 64,354,370 probably null Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Gm13084 A T 4: 143,812,009 W131R probably benign Het
Gm6614 A T 6: 141,994,855 Y93* probably null Het
Gm9745 A T 13: 8,942,657 Y91* probably null Het
Hectd4 A G 5: 121,348,815 D3291G possibly damaging Het
Hid1 A G 11: 115,348,819 W762R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Inpp4b T A 8: 81,890,694 probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Jph1 T G 1: 17,004,363 Q477P probably benign Het
Kdm4c A T 4: 74,334,728 I511L probably benign Het
Lrp2 T C 2: 69,502,553 D1540G probably damaging Het
Lrrc69 T A 4: 14,769,648 I168F probably damaging Het
Mgat4e A T 1: 134,540,991 probably benign Het
Mroh7 C A 4: 106,702,618 G704V probably damaging Het
Nadsyn1 C T 7: 143,812,579 probably null Het
Ncoa2 A T 1: 13,180,550 C303S probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Nrcam T C 12: 44,564,256 Y554H probably damaging Het
Nubpl G A 12: 52,105,276 probably benign Het
Oasl2 C A 5: 114,899,767 T75K possibly damaging Het
Olfr1099 A T 2: 86,959,272 F62Y probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Parp14 A G 16: 35,863,539 V139A probably benign Het
Pgam5 G A 5: 110,267,093 P85S probably damaging Het
Phpt1 T C 2: 25,573,695 Y96C probably damaging Het
Plekhm2 A C 4: 141,628,289 S867A possibly damaging Het
Prss21 A G 17: 23,868,785 probably null Het
Rabgap1l A T 1: 160,735,684 Y108N probably damaging Het
Riox1 C T 12: 83,951,692 T334I possibly damaging Het
Rps3a2 G T 14: 88,123,047 noncoding transcript Het
Selenot C T 3: 58,586,026 A108V probably benign Het
Setd3 A T 12: 108,160,285 M98K probably benign Het
Slc22a27 T C 19: 7,926,670 H34R possibly damaging Het
Sp3 A G 2: 72,971,459 L70S probably damaging Het
Syne2 TCCAGGTAGGGCACACC TCC 12: 76,027,856 probably null Het
Tcl1b4 C A 12: 105,202,547 D23E possibly damaging Het
Tespa1 T A 10: 130,354,769 probably null Het
Trps1 T A 15: 50,827,304 Q14L probably benign Het
Vmn2r73 A G 7: 85,858,091 V671A probably damaging Het
Zfp106 G A 2: 120,524,471 S1273F probably damaging Het
Zfp90 C A 8: 106,425,078 Y474* probably null Het
Other mutations in Tmc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Tmc7 APN 7 118552762 missense probably damaging 1.00
IGL01456:Tmc7 APN 7 118547310 splice site probably benign
IGL01784:Tmc7 APN 7 118547315 critical splice donor site probably null
IGL02158:Tmc7 APN 7 118538211 missense probably damaging 1.00
PIT4403001:Tmc7 UTSW 7 118547400 missense probably benign 0.04
PIT4403001:Tmc7 UTSW 7 118547401 missense possibly damaging 0.86
PIT4696001:Tmc7 UTSW 7 118564343 missense probably benign 0.04
R1164:Tmc7 UTSW 7 118542024 missense probably benign 0.01
R1169:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1170:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1420:Tmc7 UTSW 7 118566217 nonsense probably null
R1885:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1886:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1887:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1923:Tmc7 UTSW 7 118545627 missense probably benign 0.08
R2220:Tmc7 UTSW 7 118552816 missense possibly damaging 0.87
R4858:Tmc7 UTSW 7 118543342 missense probably damaging 1.00
R5000:Tmc7 UTSW 7 118558854 critical splice donor site probably null
R5038:Tmc7 UTSW 7 118543365 missense probably damaging 1.00
R5075:Tmc7 UTSW 7 118552696 critical splice donor site probably null
R5272:Tmc7 UTSW 7 118561053 missense probably benign
R5800:Tmc7 UTSW 7 118539440 missense probably benign
R5889:Tmc7 UTSW 7 118566326 missense probably benign 0.00
R5939:Tmc7 UTSW 7 118545727 missense probably benign 0.33
R6251:Tmc7 UTSW 7 118561038 missense possibly damaging 0.83
R6642:Tmc7 UTSW 7 118545611 nonsense probably null
R6644:Tmc7 UTSW 7 118538162 missense probably benign
R6814:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6872:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6967:Tmc7 UTSW 7 118547678 missense probably benign 0.00
R7165:Tmc7 UTSW 7 118555934 missense probably benign 0.00
R7492:Tmc7 UTSW 7 118541966 missense probably benign 0.00
R7543:Tmc7 UTSW 7 118545756 missense probably benign 0.01
R8048:Tmc7 UTSW 7 118566245 missense not run
Predicted Primers PCR Primer
(F):5'- CAGGGTCATGGTTCAGTTCTCC -3'
(R):5'- AGACTATTGTAAATGCCTGTGCTG -3'

Sequencing Primer
(F):5'- CATGGTTCAGTTCTCCAATCTGGG -3'
(R):5'- AGACCTCTCAGCCTGTGC -3'
Posted On2016-11-09