Incidental Mutation 'H8562:Dync1h1'
ID 44372
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Name dynein cytoplasmic 1 heavy chain 1
Synonyms MAP1C, Loa, Dnec1, Dnchc1, dynein heavy chain, retrograde transport, 9930018I23Rik, Swl
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # H8562 (G3) of strain 604
Quality Score 219
Status Validated
Chromosome 12
Chromosomal Location 110567886-110633379 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110583241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 446 (M446T)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
AlphaFold no structure available at present
PDB Structure Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000018851
AA Change: M446T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: M446T

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,771,717 (GRCm39) C400R probably damaging Het
4930519F16Rik A T X: 102,299,463 (GRCm39) noncoding transcript Het
5430402E10Rik G T X: 76,966,340 (GRCm39) H117Q probably damaging Het
Abca15 T C 7: 119,974,077 (GRCm39) probably benign Het
Abca8a A G 11: 109,933,835 (GRCm39) I1190T probably benign Het
Acmsd T C 1: 127,676,795 (GRCm39) Y107H probably benign Het
Adcy5 A G 16: 35,087,551 (GRCm39) I471V probably damaging Het
Aff2 G A X: 68,892,532 (GRCm39) A939T unknown Het
Ampd2 C A 3: 107,988,427 (GRCm39) A11S probably benign Het
Aoah T A 13: 21,000,694 (GRCm39) C43S probably damaging Het
Apobec4 T C 1: 152,632,925 (GRCm39) S318P probably damaging Het
Arid2 C T 15: 96,267,427 (GRCm39) P636S possibly damaging Het
Atp13a3 A T 16: 30,178,543 (GRCm39) C164* probably null Het
Avl9 G A 6: 56,734,295 (GRCm39) A625T probably damaging Het
Bco1 G T 8: 117,832,386 (GRCm39) probably benign Het
Brd3 C T 2: 27,340,545 (GRCm39) G555S possibly damaging Het
Brd4 A T 17: 32,448,377 (GRCm39) probably benign Het
Btbd7 A G 12: 102,754,561 (GRCm39) V735A probably benign Het
C2cd2 G T 16: 97,680,840 (GRCm39) Q325K possibly damaging Het
Carmil1 A G 13: 24,248,630 (GRCm39) V485A probably benign Het
Casz1 T C 4: 149,017,908 (GRCm39) L113P probably damaging Het
Ccdc3 T C 2: 5,143,016 (GRCm39) L91S probably damaging Het
Cd180 A G 13: 102,841,926 (GRCm39) K324R probably benign Het
Cd200r4 A G 16: 44,653,736 (GRCm39) T132A possibly damaging Het
Cops7a A G 6: 124,939,416 (GRCm39) probably benign Het
Cyp2c29 A T 19: 39,298,106 (GRCm39) N217I probably damaging Het
Dapk1 C A 13: 60,909,126 (GRCm39) H1246Q probably damaging Het
Dmbt1 T A 7: 130,713,805 (GRCm39) C1450* probably null Het
Dnah10 T A 5: 124,906,593 (GRCm39) M4151K probably damaging Het
Dnai1 C A 4: 41,629,833 (GRCm39) F452L possibly damaging Het
Dytn A C 1: 63,714,071 (GRCm39) S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 (GRCm39) L289Q possibly damaging Het
Efemp2 G T 19: 5,530,677 (GRCm39) V250L probably benign Het
Elmo1 T C 13: 20,465,033 (GRCm39) S201P probably damaging Het
Fam222b T A 11: 78,045,404 (GRCm39) C194S probably damaging Het
Fam91a1 G A 15: 58,298,970 (GRCm39) probably null Het
Fcf1 T A 12: 85,027,386 (GRCm39) probably benign Het
Fnip1 T A 11: 54,371,123 (GRCm39) F134L probably damaging Het
Fyn T C 10: 39,387,950 (GRCm39) S69P probably benign Het
Gabbr1 T C 17: 37,382,841 (GRCm39) Y845H probably damaging Het
Gfra2 C T 14: 71,215,818 (GRCm39) T169M possibly damaging Het
Gm5435 T C 12: 82,542,449 (GRCm39) noncoding transcript Het
Gm7251 A G 13: 49,959,148 (GRCm39) Y94H probably damaging Het
Gvin3 A G 7: 106,202,356 (GRCm39) F296S probably damaging Het
H2bc15 T C 13: 21,938,648 (GRCm39) V119A probably benign Het
Heatr1 T A 13: 12,423,594 (GRCm39) N530K probably benign Het
Icam5 A T 9: 20,946,442 (GRCm39) E355V probably benign Het
Ighv3-6 A G 12: 114,252,158 (GRCm39) probably benign Het
Intu T C 3: 40,647,103 (GRCm39) S659P probably damaging Het
Ivns1abp T C 1: 151,230,446 (GRCm39) V198A probably damaging Het
Katnb1 T A 8: 95,822,138 (GRCm39) probably benign Het
Kcna5 T C 6: 126,510,386 (GRCm39) S581G probably damaging Het
Kif23 A G 9: 61,831,347 (GRCm39) V741A probably benign Het
Lbr A T 1: 181,648,233 (GRCm39) probably benign Het
Loxhd1 A C 18: 77,429,627 (GRCm39) T508P possibly damaging Het
Lrrk2 T A 15: 91,557,561 (GRCm39) N26K probably benign Het
Ly96 A T 1: 16,761,918 (GRCm39) K41N probably damaging Het
Lypd1 C T 1: 125,838,274 (GRCm39) probably benign Het
Macf1 A G 4: 123,359,833 (GRCm39) V1817A probably benign Het
Mknk2 A G 10: 80,504,768 (GRCm39) probably benign Het
Mmp19 A T 10: 128,631,470 (GRCm39) I117L probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mtrr T C 13: 68,712,496 (GRCm39) H630R probably damaging Het
Nfat5 T C 8: 108,066,014 (GRCm39) probably benign Het
Ngef C A 1: 87,415,529 (GRCm39) K288N possibly damaging Het
Nkain4 T C 2: 180,584,938 (GRCm39) E71G probably benign Het
Odc1 T C 12: 17,598,038 (GRCm39) Y122H probably benign Het
Or1e25 T C 11: 73,494,273 (GRCm39) I289T probably damaging Het
Or2d2 C A 7: 106,728,448 (GRCm39) A51S probably benign Het
Or8g51 C A 9: 38,609,206 (GRCm39) G156V probably damaging Het
Osbpl3 A T 6: 50,324,446 (GRCm39) N190K probably benign Het
Osgepl1 T C 1: 53,354,198 (GRCm39) V54A probably damaging Het
Otogl T C 10: 107,746,817 (GRCm39) Y19C probably benign Het
Pop1 T C 15: 34,530,358 (GRCm39) S919P probably benign Het
Pramel21 T A 4: 143,341,920 (GRCm39) probably benign Het
Prl8a9 A G 13: 27,746,584 (GRCm39) probably benign Het
Prr14l A T 5: 32,951,072 (GRCm39) V1907D probably damaging Het
Ptprn T C 1: 75,231,264 (GRCm39) T547A possibly damaging Het
Rdh14 G T 12: 10,444,709 (GRCm39) V187F probably damaging Het
Rev1 A G 1: 38,095,848 (GRCm39) L853P probably damaging Het
Robo4 T C 9: 37,317,106 (GRCm39) probably benign Het
Ryr2 A G 13: 11,732,027 (GRCm39) probably benign Het
Sec16a G A 2: 26,331,517 (GRCm39) P166L probably benign Het
Slc6a19 G A 13: 73,848,243 (GRCm39) probably benign Het
Slco4c1 T A 1: 96,770,210 (GRCm39) T285S probably benign Het
Speg G T 1: 75,392,241 (GRCm39) A1633S probably benign Het
Srpk1 T A 17: 28,821,707 (GRCm39) T236S probably benign Het
Stxbp5 T C 10: 9,645,187 (GRCm39) N262S probably benign Het
Suco T C 1: 161,680,420 (GRCm39) E317G probably damaging Het
Syk A G 13: 52,794,657 (GRCm39) N441D probably damaging Het
Syt17 T C 7: 118,007,292 (GRCm39) K334R probably benign Het
Sytl5 A T X: 9,826,335 (GRCm39) H436L probably benign Het
Tasor2 A T 13: 3,627,000 (GRCm39) S983R probably damaging Het
Thada A G 17: 84,753,972 (GRCm39) L333P probably damaging Het
Thap12 T C 7: 98,364,314 (GRCm39) Y161H probably damaging Het
Thbs2 C T 17: 14,891,715 (GRCm39) V941I probably benign Het
Tktl1 A T X: 73,225,470 (GRCm39) E72V probably damaging Het
Tm4sf5 T A 11: 70,396,338 (GRCm39) probably benign Het
Urb1 T A 16: 90,566,357 (GRCm39) M1477L probably benign Het
Vcp T A 4: 42,982,596 (GRCm39) I699F probably damaging Het
Vmn1r232 T C 17: 21,133,656 (GRCm39) T315A probably benign Het
Vmn2r100 T A 17: 19,741,752 (GRCm39) W155R possibly damaging Het
Vmn2r19 T C 6: 123,292,861 (GRCm39) I301T possibly damaging Het
Wwc2 A G 8: 48,373,701 (GRCm39) V55A possibly damaging Het
Xirp2 A G 2: 67,345,801 (GRCm39) T2681A probably benign Het
Zfp39 C A 11: 58,791,512 (GRCm39) L58F probably damaging Het
Zfp612 T C 8: 110,816,670 (GRCm39) F587L probably damaging Het
Zfp810 T C 9: 22,190,387 (GRCm39) R174G probably benign Het
Zfta A G 19: 7,400,286 (GRCm39) K251E probably benign Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110,615,538 (GRCm39) missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110,580,541 (GRCm39) missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110,592,041 (GRCm39) splice site probably benign
IGL01324:Dync1h1 APN 12 110,593,299 (GRCm39) missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110,583,126 (GRCm39) splice site probably benign
IGL01371:Dync1h1 APN 12 110,605,285 (GRCm39) missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110,624,562 (GRCm39) missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110,581,374 (GRCm39) missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110,625,364 (GRCm39) missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110,618,630 (GRCm39) critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110,603,558 (GRCm39) missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110,599,254 (GRCm39) missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110,628,993 (GRCm39) missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110,629,436 (GRCm39) missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110,607,322 (GRCm39) missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110,606,644 (GRCm39) missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110,625,666 (GRCm39) nonsense probably null
IGL02643:Dync1h1 APN 12 110,625,706 (GRCm39) unclassified probably benign
IGL03076:Dync1h1 APN 12 110,624,327 (GRCm39) missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110,632,989 (GRCm39) splice site probably null
IGL03293:Dync1h1 APN 12 110,595,168 (GRCm39) missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110,585,644 (GRCm39) missense possibly damaging 0.49
chinashop UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
Gesund UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
gymnast UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
Lightfoot UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
Lissom UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
Strong UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
waters UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110,615,538 (GRCm39) missense probably benign 0.31
R0082:Dync1h1 UTSW 12 110,602,880 (GRCm39) missense probably benign
R0110:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110,585,108 (GRCm39) missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110,598,126 (GRCm39) missense probably benign
R0450:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110,599,222 (GRCm39) missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110,582,930 (GRCm39) missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110,618,181 (GRCm39) unclassified probably benign
R0685:Dync1h1 UTSW 12 110,623,626 (GRCm39) missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110,595,718 (GRCm39) missense probably damaging 0.99
R0747:Dync1h1 UTSW 12 110,578,845 (GRCm39) missense probably benign
R0843:Dync1h1 UTSW 12 110,631,647 (GRCm39) missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110,632,393 (GRCm39) missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110,615,698 (GRCm39) missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110,622,791 (GRCm39) missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110,632,096 (GRCm39) critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110,593,426 (GRCm39) missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110,599,362 (GRCm39) splice site probably benign
R1812:Dync1h1 UTSW 12 110,629,334 (GRCm39) missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110,629,059 (GRCm39) missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110,591,070 (GRCm39) missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110,612,738 (GRCm39) missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110,629,063 (GRCm39) missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110,592,166 (GRCm39) missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110,632,857 (GRCm39) critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110,581,026 (GRCm39) missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110,616,022 (GRCm39) missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110,596,420 (GRCm39) missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110,607,316 (GRCm39) missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110,623,065 (GRCm39) missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110,607,654 (GRCm39) missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110,609,681 (GRCm39) missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110,583,325 (GRCm39) missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110,607,460 (GRCm39) critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110,607,020 (GRCm39) missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110,609,563 (GRCm39) missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3736:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3882:Dync1h1 UTSW 12 110,595,492 (GRCm39) missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110,632,399 (GRCm39) missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110,609,624 (GRCm39) missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110,584,483 (GRCm39) nonsense probably null
R4355:Dync1h1 UTSW 12 110,599,333 (GRCm39) missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110,623,573 (GRCm39) missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110,615,917 (GRCm39) missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110,605,278 (GRCm39) missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110,595,201 (GRCm39) missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110,628,975 (GRCm39) missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110,621,962 (GRCm39) missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4733:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4780:Dync1h1 UTSW 12 110,627,630 (GRCm39) missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110,606,235 (GRCm39) missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110,629,289 (GRCm39) missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110,584,444 (GRCm39) missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110,593,326 (GRCm39) nonsense probably null
R5036:Dync1h1 UTSW 12 110,596,969 (GRCm39) missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110,607,341 (GRCm39) missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110,584,366 (GRCm39) missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110,596,114 (GRCm39) missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110,595,264 (GRCm39) missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110,581,502 (GRCm39) missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110,599,099 (GRCm39) missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110,627,384 (GRCm39) missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110,607,575 (GRCm39) missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110,632,422 (GRCm39) missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110,595,496 (GRCm39) missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110,612,707 (GRCm39) nonsense probably null
R5806:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110,580,654 (GRCm39) critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110,599,212 (GRCm39) missense probably benign
R6113:Dync1h1 UTSW 12 110,586,848 (GRCm39) missense probably benign
R6119:Dync1h1 UTSW 12 110,594,440 (GRCm39) missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110,584,427 (GRCm39) missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110,612,639 (GRCm39) missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110,583,171 (GRCm39) missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110,616,282 (GRCm39) missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110,624,981 (GRCm39) missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110,618,614 (GRCm39) missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110,590,995 (GRCm39) missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110,605,335 (GRCm39) missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110,632,521 (GRCm39) nonsense probably null
R7096:Dync1h1 UTSW 12 110,623,512 (GRCm39) missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110,568,173 (GRCm39) missense probably benign
R7224:Dync1h1 UTSW 12 110,584,196 (GRCm39) missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110,631,183 (GRCm39) critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110,631,596 (GRCm39) missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110,602,076 (GRCm39) missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110,591,036 (GRCm39) missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110,600,654 (GRCm39) missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110,632,109 (GRCm39) missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110,618,011 (GRCm39) missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110,580,541 (GRCm39) missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110,597,059 (GRCm39) missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110,627,327 (GRCm39) missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110,585,080 (GRCm39) missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110,632,200 (GRCm39) missense probably damaging 1.00
R7808:Dync1h1 UTSW 12 110,621,893 (GRCm39) missense possibly damaging 0.53
R7891:Dync1h1 UTSW 12 110,609,590 (GRCm39) missense probably benign 0.02
R7895:Dync1h1 UTSW 12 110,582,891 (GRCm39) missense probably damaging 1.00
R7913:Dync1h1 UTSW 12 110,595,168 (GRCm39) missense probably benign 0.12
R8164:Dync1h1 UTSW 12 110,582,794 (GRCm39) missense possibly damaging 0.91
R8257:Dync1h1 UTSW 12 110,602,908 (GRCm39) missense probably damaging 1.00
R8346:Dync1h1 UTSW 12 110,632,226 (GRCm39) missense probably benign 0.21
R8432:Dync1h1 UTSW 12 110,584,576 (GRCm39) missense probably benign 0.00
R8510:Dync1h1 UTSW 12 110,583,177 (GRCm39) missense possibly damaging 0.94
R8731:Dync1h1 UTSW 12 110,607,018 (GRCm39) missense possibly damaging 0.93
R8739:Dync1h1 UTSW 12 110,581,014 (GRCm39) missense probably damaging 1.00
R8756:Dync1h1 UTSW 12 110,583,261 (GRCm39) missense probably benign 0.06
R8855:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8866:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8885:Dync1h1 UTSW 12 110,583,172 (GRCm39) missense probably damaging 1.00
R8893:Dync1h1 UTSW 12 110,608,477 (GRCm39) missense probably damaging 1.00
R8913:Dync1h1 UTSW 12 110,624,602 (GRCm39) missense probably benign 0.14
R8937:Dync1h1 UTSW 12 110,584,471 (GRCm39) missense probably damaging 1.00
R8958:Dync1h1 UTSW 12 110,586,805 (GRCm39) missense probably benign 0.00
R9000:Dync1h1 UTSW 12 110,606,397 (GRCm39) missense probably benign
R9036:Dync1h1 UTSW 12 110,606,186 (GRCm39) missense probably benign
R9090:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9108:Dync1h1 UTSW 12 110,622,706 (GRCm39) intron probably benign
R9161:Dync1h1 UTSW 12 110,625,023 (GRCm39) missense probably benign 0.01
R9185:Dync1h1 UTSW 12 110,601,937 (GRCm39) missense probably benign 0.33
R9271:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9436:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9478:Dync1h1 UTSW 12 110,625,137 (GRCm39) missense probably benign 0.02
R9547:Dync1h1 UTSW 12 110,624,805 (GRCm39) missense probably damaging 1.00
R9561:Dync1h1 UTSW 12 110,615,533 (GRCm39) missense probably damaging 0.99
R9586:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9609:Dync1h1 UTSW 12 110,607,362 (GRCm39) missense probably benign 0.01
Z1088:Dync1h1 UTSW 12 110,596,351 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,624,951 (GRCm39) nonsense probably null
Z1177:Dync1h1 UTSW 12 110,607,611 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,603,988 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGAAGTACCCGATTCAGCG -3'
(R):5'- AAACATGGAGTACCAGGCCGTCAG -3'

Sequencing Primer
(F):5'- CAGAGACCTGAGTTCTCAGC -3'
(R):5'- ACCAGGCCGTCAGTTCTTTC -3'
Posted On 2013-06-11