Incidental Mutation 'R5692:Aqp7'
ID443721
Institutional Source Beutler Lab
Gene Symbol Aqp7
Ensembl Gene ENSMUSG00000028427
Gene Nameaquaporin 7
SynonymsAQPap, AQP7L
MMRRC Submission 043179-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5692 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41033074-41048139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41035510 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 115 (T115I)
Ref Sequence ENSEMBL: ENSMUSP00000093007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030136] [ENSMUST00000054945]
Predicted Effect probably benign
Transcript: ENSMUST00000030136
AA Change: T115I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030136
Gene: ENSMUSG00000028427
AA Change: T115I

DomainStartEndE-ValueType
Pfam:MIP 12 257 7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054945
AA Change: T115I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093007
Gene: ENSMUSG00000028427
AA Change: T115I

DomainStartEndE-ValueType
Pfam:MIP 12 257 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149517
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice for one allele show decreased circulating glycerol levels and fasting hypoglycemia. Other mutant alleles show increased gonadal fat pad mass and adipocyte hypertrophy or increased urine glucose and impaired water permeability in the kidney, but have normal serum glycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik G A 9: 8,221,990 noncoding transcript Het
Adcy10 A G 1: 165,515,306 N247S probably benign Het
Ago3 T C 4: 126,355,069 probably null Het
Aldh16a1 A G 7: 45,147,799 V168A probably damaging Het
Arhgap26 T A 18: 39,121,892 V274E probably damaging Het
Clec4d T C 6: 123,268,145 probably null Het
Dennd4b T C 3: 90,277,783 Y1166H probably damaging Het
Egln3 T C 12: 54,180,661 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fhad1 T A 4: 141,963,457 M434L probably benign Het
Gfm1 T G 3: 67,435,622 M163R probably damaging Het
Isg15 A T 4: 156,199,822 L83Q probably damaging Het
Ly9 GCCTTTGGGGGACAATTCC GCC 1: 171,605,187 probably null Het
Med1 G T 11: 98,156,380 probably benign Het
Mrc2 T A 11: 105,336,642 V567D probably damaging Het
Nnmt G T 9: 48,603,480 T79K probably benign Het
Opn1sw G A 6: 29,379,841 probably benign Het
Optc G T 1: 133,900,976 probably benign Het
Pcdh17 C T 14: 84,448,540 P816S probably benign Het
Pcdhb15 T C 18: 37,474,449 S245P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Sacs T C 14: 61,207,839 F2445L probably benign Het
Sel1l T C 12: 91,811,878 N721S probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Sulf2 C A 2: 166,081,506 A598S probably benign Het
Tph2 A T 10: 115,184,827 D21E probably damaging Het
Trf T C 9: 103,226,125 Y110C possibly damaging Het
Ttn C T 2: 76,797,858 E14653K possibly damaging Het
Vmn2r18 A G 5: 151,562,259 I590T possibly damaging Het
Zfp607b G T 7: 27,703,464 K448N probably benign Het
Zfp689 T C 7: 127,448,899 probably benign Het
Zfp709 C T 8: 71,890,155 P476L probably damaging Het
Other mutations in Aqp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Aqp7 APN 4 41045321 nonsense probably null
IGL01871:Aqp7 APN 4 41045321 nonsense probably null
IGL02173:Aqp7 APN 4 41034379 nonsense probably null
IGL03139:Aqp7 APN 4 41045326 missense probably benign 0.00
IGL03237:Aqp7 APN 4 41034884 missense possibly damaging 0.68
IGL03241:Aqp7 APN 4 41045270 splice site probably benign
acadia UTSW 4 41035510 missense probably benign 0.00
IGL03055:Aqp7 UTSW 4 41045326 missense probably benign 0.00
R0884:Aqp7 UTSW 4 41034929 missense possibly damaging 0.86
R1617:Aqp7 UTSW 4 41036109 missense probably null 0.74
R3551:Aqp7 UTSW 4 41045329 missense probably benign 0.04
R5340:Aqp7 UTSW 4 41034347 missense probably benign
R5689:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5690:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5691:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5710:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5711:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5713:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5751:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5817:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5820:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5921:Aqp7 UTSW 4 41036093 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGCTTTACTCTACTAGGGTTG -3'
(R):5'- GTGCGGTCTTTTCACAGAGAAC -3'

Sequencing Primer
(F):5'- ACTCTACTAGGGTTGGGGATTTG -3'
(R):5'- GGTCTTTTCACAGAGAACATCCC -3'
Posted On2016-11-09