Incidental Mutation 'R5692:Tph2'
ID443740
Institutional Source Beutler Lab
Gene Symbol Tph2
Ensembl Gene ENSMUSG00000006764
Gene Nametryptophan hydroxylase 2
Synonyms
MMRRC Submission 043179-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R5692 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115078641-115185022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115184827 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 21 (D21E)
Ref Sequence ENSEMBL: ENSMUSP00000006949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006949]
Predicted Effect probably damaging
Transcript: ENSMUST00000006949
AA Change: D21E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: D21E

DomainStartEndE-ValueType
low complexity region 94 102 N/A INTRINSIC
Pfam:Biopterin_H 150 480 3.6e-177 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik G A 9: 8,221,990 noncoding transcript Het
Adcy10 A G 1: 165,515,306 N247S probably benign Het
Ago3 T C 4: 126,355,069 probably null Het
Aldh16a1 A G 7: 45,147,799 V168A probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap26 T A 18: 39,121,892 V274E probably damaging Het
Clec4d T C 6: 123,268,145 probably null Het
Dennd4b T C 3: 90,277,783 Y1166H probably damaging Het
Egln3 T C 12: 54,180,661 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fhad1 T A 4: 141,963,457 M434L probably benign Het
Gfm1 T G 3: 67,435,622 M163R probably damaging Het
Isg15 A T 4: 156,199,822 L83Q probably damaging Het
Ly9 GCCTTTGGGGGACAATTCC GCC 1: 171,605,187 probably null Het
Med1 G T 11: 98,156,380 probably benign Het
Mrc2 T A 11: 105,336,642 V567D probably damaging Het
Nnmt G T 9: 48,603,480 T79K probably benign Het
Opn1sw G A 6: 29,379,841 probably benign Het
Optc G T 1: 133,900,976 probably benign Het
Pcdh17 C T 14: 84,448,540 P816S probably benign Het
Pcdhb15 T C 18: 37,474,449 S245P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Sacs T C 14: 61,207,839 F2445L probably benign Het
Sel1l T C 12: 91,811,878 N721S probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Sulf2 C A 2: 166,081,506 A598S probably benign Het
Trf T C 9: 103,226,125 Y110C possibly damaging Het
Ttn C T 2: 76,797,858 E14653K possibly damaging Het
Vmn2r18 A G 5: 151,562,259 I590T possibly damaging Het
Zfp607b G T 7: 27,703,464 K448N probably benign Het
Zfp689 T C 7: 127,448,899 probably benign Het
Zfp709 C T 8: 71,890,155 P476L probably damaging Het
Other mutations in Tph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Tph2 APN 10 115079759 nonsense probably null
IGL01989:Tph2 APN 10 115146016 missense probably benign 0.22
IGL02363:Tph2 APN 10 115079981 missense probably benign 0.01
IGL02667:Tph2 APN 10 115080045 missense probably benign 0.43
R0390:Tph2 UTSW 10 115174109 missense probably damaging 1.00
R0400:Tph2 UTSW 10 115080120 splice site probably benign
R0570:Tph2 UTSW 10 115174134 splice site probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1654:Tph2 UTSW 10 115184807 missense probably benign
R3705:Tph2 UTSW 10 115119893 nonsense probably null
R3710:Tph2 UTSW 10 115174058 missense probably benign 0.42
R3777:Tph2 UTSW 10 115080005 missense probably benign
R4794:Tph2 UTSW 10 115182770 missense possibly damaging 0.84
R5015:Tph2 UTSW 10 115079716 missense probably benign 0.01
R5068:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5069:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5070:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5422:Tph2 UTSW 10 115079764 missense possibly damaging 0.94
R5487:Tph2 UTSW 10 115119874 missense probably damaging 1.00
R5604:Tph2 UTSW 10 115090709 missense probably damaging 1.00
R6368:Tph2 UTSW 10 115179326 missense probably damaging 1.00
R6802:Tph2 UTSW 10 115184873 missense probably damaging 1.00
R6823:Tph2 UTSW 10 115174106 missense probably benign 0.02
R7371:Tph2 UTSW 10 115151111 missense probably damaging 1.00
R7724:Tph2 UTSW 10 115079822 missense probably benign
R7863:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R8046:Tph2 UTSW 10 115179594 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCCAGCTGCTTGTACTTTGTGG -3'
(R):5'- TCTTCAGCACCAGGGTTCTG -3'

Sequencing Primer
(F):5'- TTTGTGGAGAGCTGAGGCAGAC -3'
(R):5'- AGGGTTCTGGACAGCGC -3'
Posted On2016-11-09