Incidental Mutation 'R5693:Gpc1'
ID443752
Institutional Source Beutler Lab
Gene Symbol Gpc1
Ensembl Gene ENSMUSG00000034220
Gene Nameglypican 1
Synonyms
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92831645-92860779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92857899 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 437 (N437S)
Ref Sequence ENSEMBL: ENSMUSP00000047199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045970]
Predicted Effect probably damaging
Transcript: ENSMUST00000045970
AA Change: N437S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047199
Gene: ENSMUSG00000034220
AA Change: N437S

DomainStartEndE-ValueType
Pfam:Glypican 11 553 6.2e-228 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190677
Predicted Effect probably benign
Transcript: ENSMUST00000212504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a reduced brain size with mild cerebellar patterning defects, but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Gpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Gpc1 APN 1 92857014 missense probably damaging 1.00
IGL01697:Gpc1 APN 1 92858410 missense possibly damaging 0.93
IGL02282:Gpc1 APN 1 92857967 missense probably damaging 1.00
IGL02930:Gpc1 APN 1 92857299 nonsense probably null
IGL03160:Gpc1 APN 1 92857857 missense probably damaging 1.00
PIT4514001:Gpc1 UTSW 1 92857557 missense probably benign 0.05
R0115:Gpc1 UTSW 1 92857499 missense probably damaging 1.00
R0383:Gpc1 UTSW 1 92854983 missense probably damaging 1.00
R0399:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0938:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0941:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0942:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R2483:Gpc1 UTSW 1 92855938 missense probably benign 0.35
R3749:Gpc1 UTSW 1 92857582 nonsense probably null
R5033:Gpc1 UTSW 1 92857029 missense probably damaging 0.97
R5154:Gpc1 UTSW 1 92857029 missense probably damaging 0.97
R5362:Gpc1 UTSW 1 92854893 missense probably benign 0.00
R5626:Gpc1 UTSW 1 92857119 critical splice donor site probably null
R7268:Gpc1 UTSW 1 92858371 missense possibly damaging 0.76
R7790:Gpc1 UTSW 1 92853449 missense probably benign
R7875:Gpc1 UTSW 1 92855248 critical splice donor site probably null
X0020:Gpc1 UTSW 1 92854981 missense probably benign 0.00
Z1177:Gpc1 UTSW 1 92857486 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGGAGGATCCCACACATTC -3'
(R):5'- TACCCTTCCACTTCTGAGCAGG -3'

Sequencing Primer
(F):5'- ACCATGGAGCCCGCATG -3'
(R):5'- ACTAGCATCCTGGAAGTC -3'
Posted On2016-11-09