Incidental Mutation 'R5693:Tyro3'
ID443753
Institutional Source Beutler Lab
Gene Symbol Tyro3
Ensembl Gene ENSMUSG00000027298
Gene NameTYRO3 protein tyrosine kinase 3
SynonymsBrt, Etk-2, Sky, Sky, Dtk, Rse, Tif
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119797733-119818104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119810868 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 519 (F519L)
Ref Sequence ENSEMBL: ENSMUSP00000028763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028763] [ENSMUST00000110783]
PDB Structure
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028763
AA Change: F519L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028763
Gene: ENSMUSG00000027298
AA Change: F519L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc2 45 114 1.29e-15 SMART
IG 135 212 1.3e-2 SMART
FN3 215 297 1.5e-5 SMART
FN3 313 393 1.9e0 SMART
transmembrane domain 419 441 N/A INTRINSIC
TyrKc 508 776 1.18e-125 SMART
low complexity region 817 832 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110783
AA Change: F515L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106410
Gene: ENSMUSG00000027298
AA Change: F515L

DomainStartEndE-ValueType
IGc2 41 110 1.29e-15 SMART
IG 131 208 1.3e-2 SMART
FN3 211 293 1.5e-5 SMART
FN3 309 389 1.9e0 SMART
transmembrane domain 415 437 N/A INTRINSIC
TyrKc 504 772 1.18e-125 SMART
low complexity region 813 828 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147761
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Tyro3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Tyro3 APN 2 119813200 missense probably damaging 1.00
IGL02221:Tyro3 APN 2 119812590 missense probably benign 0.00
IGL02389:Tyro3 APN 2 119804864 splice site probably benign
IGL02442:Tyro3 APN 2 119808868 missense probably benign 0.16
PIT4382001:Tyro3 UTSW 2 119802364 missense probably damaging 1.00
R0078:Tyro3 UTSW 2 119817006 missense probably damaging 1.00
R0087:Tyro3 UTSW 2 119801701 missense probably benign 0.38
R0503:Tyro3 UTSW 2 119803230 splice site probably benign
R0551:Tyro3 UTSW 2 119816904 missense probably damaging 1.00
R1858:Tyro3 UTSW 2 119801695 missense possibly damaging 0.95
R1902:Tyro3 UTSW 2 119801695 missense possibly damaging 0.73
R1980:Tyro3 UTSW 2 119808817 missense probably benign
R2294:Tyro3 UTSW 2 119805645 missense probably damaging 0.99
R3877:Tyro3 UTSW 2 119813293 missense probably damaging 0.98
R4651:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4652:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4698:Tyro3 UTSW 2 119803270 missense probably damaging 1.00
R4757:Tyro3 UTSW 2 119810938 missense probably damaging 1.00
R4894:Tyro3 UTSW 2 119802298 missense probably damaging 0.96
R5193:Tyro3 UTSW 2 119810517 missense probably damaging 1.00
R5366:Tyro3 UTSW 2 119804831 missense probably damaging 1.00
R6017:Tyro3 UTSW 2 119816666 missense probably damaging 1.00
R6110:Tyro3 UTSW 2 119812823 missense probably damaging 1.00
R6160:Tyro3 UTSW 2 119803270 missense probably damaging 0.98
R6290:Tyro3 UTSW 2 119816840 missense probably benign
R6293:Tyro3 UTSW 2 119808000 missense possibly damaging 0.89
R6366:Tyro3 UTSW 2 119816675 missense probably damaging 0.96
R6712:Tyro3 UTSW 2 119804854 missense probably null 0.44
R7645:Tyro3 UTSW 2 119816906 missense probably damaging 1.00
Z1088:Tyro3 UTSW 2 119809467 missense probably benign 0.31
Z1177:Tyro3 UTSW 2 119809991 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAGTTGCTTCCAGGGTATG -3'
(R):5'- TTGGGAAATCTCAGGCAGAG -3'

Sequencing Primer
(F):5'- TGGGTCAGCTCCTATAAACAAG -3'
(R):5'- CAGAGTGGCGCCTGCTC -3'
Posted On2016-11-09