Incidental Mutation 'R5693:Ptprf'
ID443762
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 118236177 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 90 (R90*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]
Predicted Effect probably null
Transcript: ENSMUST00000049074
AA Change: R423*
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: R423*

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124758
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150096
AA Change: R90*
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: R90*

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222620
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7448:Ptprf UTSW 4 118235667 missense probably benign 0.03
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
R7593:Ptprf UTSW 4 118212396 missense probably benign 0.00
R8172:Ptprf UTSW 4 118211078 missense probably benign 0.03
R8239:Ptprf UTSW 4 118212112 missense possibly damaging 0.88
R8257:Ptprf UTSW 4 118226279 missense probably damaging 0.96
R8331:Ptprf UTSW 4 118226066 missense probably benign 0.27
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Z1177:Ptprf UTSW 4 118269615 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTAGGTGATGCCAGGTAG -3'
(R):5'- CTTCTACGGCATCCAGTACC -3'

Sequencing Primer
(F):5'- TGCCAGGTAGCAGGCTG -3'
(R):5'- CATCCAGTACCGCGCAG -3'
Posted On2016-11-09