Mutagenetix > Incidental Mutations

Incidental Mutation 'R5693:Abcb8'

443764

Institutional Source

Beutler Lab

Gene Symbol

Abcb8

Ensembl Gene

ENSMUSG00000028973

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 8

Synonyms

MMRRC Submission

043180-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R5693 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24393663-24410054 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24400139 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 108 (R108C)

Ref Sequence

ENSEMBL: ENSMUSP00000119791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]

Predicted Effect

probably benign
Transcript: ENSMUST00000073076
AA Change: R108C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973
AA Change: R108C

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC
Pfam:ABC_membrane	130	407	3.6e-48	PFAM
AAA	481	668	8.58e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115074

SMART Domains

Protein: ENSMUSP00000110726
Gene: ENSMUSG00000028973

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC
Pfam:ABC_membrane	130	407	2.7e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115077
AA Change: R108C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973
AA Change: R108C

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC
Pfam:ABC_membrane	130	407	1.1e-56	PFAM
AAA	481	668	8.58e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136414

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138168
AA Change: R108C

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973
AA Change: R108C

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198166

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Inducible cardiac specific deletion results in mild cardiomyopathy, mitochondrial defects and elevated heart mitochondrial iron levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,316,233	I3071V	probably benign	Het
Abr	T	C	11: 76,463,577	N236S	probably damaging	Het
Adcy6	T	C	15: 98,603,989	Y248C	probably damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Chd6	A	T	2: 160,965,265	S2010T	probably benign	Het
Dcc	G	A	18: 71,575,082	T521I	probably damaging	Het
Dmrtb1	G	A	4: 107,684,169		probably benign	Het
Evc	A	G	5: 37,320,240	V365A	possibly damaging	Het
Gata4	A	G	14: 63,241,145	Y2H	probably damaging	Het
Gpc1	A	G	1: 92,857,899	N437S	probably damaging	Het
Lifr	T	C	15: 7,175,560	V426A	probably damaging	Het
Lpin3	A	G	2: 160,895,400	I122M	probably benign	Het
Muc4	A	G	16: 32,776,807	N3174D	possibly damaging	Het
Myo6	G	A	9: 80,266,180	R534H	probably damaging	Het
Nectin2	T	C	7: 19,724,869	D339G	probably benign	Het
Olfr798	T	C	10: 129,625,527	D178G	probably damaging	Het
Oprd1	G	A	4: 132,144,410		probably benign	Het
Orc1	G	A	4: 108,613,079	V751I	probably benign	Het
Pacs2	T	C	12: 113,049,906	S175P	probably damaging	Het
Pik3r5	C	T	11: 68,494,251	R661C	probably damaging	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Prkar1b	A	G	5: 139,127,645	V40A	possibly damaging	Het
Ptprf	G	A	4: 118,236,177	R90*	probably null	Het
Rasef	T	C	4: 73,769,839	M26V	probably damaging	Het
Rfx1	C	A	8: 84,073,904	Q45K	unknown	Het
Rnf183	A	G	4: 62,428,516	V15A	possibly damaging	Het
Slc10a2	C	A	8: 5,105,128	C19F	probably damaging	Het
Slc14a2	T	A	18: 78,147,014	I907F	probably benign	Het
Snx16	T	C	3: 10,420,258	I293V	probably benign	Het
Srcap	C	A	7: 127,519,816	A97E	probably damaging	Het
Thyn1	G	T	9: 27,005,215		probably null	Het
Tiparp	T	C	3: 65,553,492	I634T	possibly damaging	Het
Tjp1	G	A	7: 65,342,663	A156V	possibly damaging	Het
Tmem168	T	C	6: 13,602,321	M349V	probably benign	Het
Tyro3	T	G	2: 119,810,868	F519L	probably damaging	Het
Vmn1r167	A	T	7: 23,505,221	Y123*	probably null	Het
Vmn1r183	C	T	7: 24,054,802	T10I	possibly damaging	Het
Zfp654	T	C	16: 64,785,926	T97A	probably benign	Het

Other mutations in Abcb8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02349:Abcb8	APN	5	24406464	missense	probably benign
IGL02819:Abcb8	APN	5	24406424	missense	probably benign
Thumbs	UTSW	5	24402103	missense	probably damaging	0.99
R0320:Abcb8	UTSW	5	24400790	missense	probably damaging	1.00
R0458:Abcb8	UTSW	5	24406233	missense	probably benign	0.02
R0927:Abcb8	UTSW	5	24402319	missense	probably damaging	1.00
R1120:Abcb8	UTSW	5	24408820	critical splice donor site	probably null
R1553:Abcb8	UTSW	5	24408750	missense	probably damaging	1.00
R3738:Abcb8	UTSW	5	24400621	missense	probably benign	0.00
R3739:Abcb8	UTSW	5	24400621	missense	probably benign	0.00
R4035:Abcb8	UTSW	5	24400621	missense	probably benign	0.00
R4303:Abcb8	UTSW	5	24401057	missense	probably damaging	1.00
R4930:Abcb8	UTSW	5	24400781	missense	possibly damaging	0.89
R5369:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5370:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5485:Abcb8	UTSW	5	24400161	missense	probably benign	0.01
R5505:Abcb8	UTSW	5	24401038	missense	probably damaging	1.00
R5627:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5633:Abcb8	UTSW	5	24403109	missense	probably damaging	1.00
R5761:Abcb8	UTSW	5	24405881	intron	probably benign
R5866:Abcb8	UTSW	5	24402103	missense	probably damaging	0.99
R5995:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5996:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R6621:Abcb8	UTSW	5	24394510	missense	probably benign
R7407:Abcb8	UTSW	5	24400676	missense	probably benign	0.00
R8026:Abcb8	UTSW	5	24406725	missense	probably damaging	1.00
R8220:Abcb8	UTSW	5	24406785	missense	possibly damaging	0.70
X0026:Abcb8	UTSW	5	24401046	missense	possibly damaging	0.95
Z1176:Abcb8	UTSW	5	24400995	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTTGAAGGACAGCCAGGC -3'
(R):5'- TGCACAGGTTATCCCGATGC -3'

Sequencing Primer
(F):5'- AGGCCCACAGCTGTCAATG -3'
(R):5'- AGGTTATCCCGATGCCCCAG -3'

Posted On

2016-11-09