Incidental Mutation 'R5693:Prkar1b'
ID443766
Institutional Source Beutler Lab
Gene Symbol Prkar1b
Ensembl Gene ENSMUSG00000025855
Gene Nameprotein kinase, cAMP dependent regulatory, type I beta
SynonymsRIbeta
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139017306-139150001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139127645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000122693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026973] [ENSMUST00000110890] [ENSMUST00000129851] [ENSMUST00000134762] [ENSMUST00000147505] [ENSMUST00000148002] [ENSMUST00000155833]
Predicted Effect probably benign
Transcript: ENSMUST00000026973
AA Change: V40A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026973
Gene: ENSMUSG00000025855
AA Change: V40A

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 253 1.07e-28 SMART
cNMP 255 374 3.95e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110890
AA Change: V40A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106515
Gene: ENSMUSG00000025855
AA Change: V40A

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 253 1.07e-28 SMART
cNMP 255 374 3.95e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129851
AA Change: V40A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121093
Gene: ENSMUSG00000025855
AA Change: V40A

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 235 1.24e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134762
AA Change: V40A

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116022
Gene: ENSMUSG00000025855
AA Change: V40A

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147505
AA Change: V40A

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116727
Gene: ENSMUSG00000025855
AA Change: V40A

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148002
AA Change: V40A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123286
Gene: ENSMUSG00000025855
AA Change: V40A

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 250 8.27e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155833
AA Change: V40A

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122693
Gene: ENSMUSG00000025855
AA Change: V40A

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of cyclic AMP-dependent protein kinase A (PKA), which is involved in the signaling pathway of the second messenger cAMP. Two regulatory and two catalytic subunits form the PKA holoenzyme, disbands after cAMP binding. The holoenzyme is involved in many cellular events, including ion transport, metabolism, and transcription. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have reduced LTD and LTP in specific CNS tracts, but normal neuroanatomy and behavior. Response to pain after inflammation is reduced, concurrent with decreased plasma extravasation during the inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Prkar1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0470:Prkar1b UTSW 5 139050749 missense probably damaging 0.98
R0558:Prkar1b UTSW 5 139020092 missense probably benign 0.04
R1512:Prkar1b UTSW 5 139050673 nonsense probably null
R1982:Prkar1b UTSW 5 139127643 missense probably benign 0.06
R4231:Prkar1b UTSW 5 139108621 missense probably benign 0.00
R5326:Prkar1b UTSW 5 139127789 splice site probably null
R5350:Prkar1b UTSW 5 139106628 missense probably damaging 1.00
R7136:Prkar1b UTSW 5 139108608 missense probably benign 0.00
RF009:Prkar1b UTSW 5 139108621 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGGCCTTATTCATGGGAG -3'
(R):5'- TCCTAAAGCTGATTGTGTCATCTG -3'

Sequencing Primer
(F):5'- TCTAGGAAGGGGCTCTACCATG -3'
(R):5'- TGTGTCATCTGTAACAGGAGCATAG -3'
Posted On2016-11-09