Incidental Mutation 'R5693:Tmem168'
ID443767
Institutional Source Beutler Lab
Gene Symbol Tmem168
Ensembl Gene ENSMUSG00000029569
Gene Nametransmembrane protein 168
Synonyms5730526F17Rik, 8430437G11Rik
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location13580687-13608100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13602321 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 349 (M349V)
Ref Sequence ENSEMBL: ENSMUSP00000031554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031554] [ENSMUST00000149123]
Predicted Effect probably benign
Transcript: ENSMUST00000031554
AA Change: M349V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031554
Gene: ENSMUSG00000029569
AA Change: M349V

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 109 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 199 216 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
transmembrane domain 298 320 N/A INTRINSIC
transmembrane domain 359 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146139
Predicted Effect probably benign
Transcript: ENSMUST00000149123
SMART Domains Protein: ENSMUSP00000145372
Gene: ENSMUSG00000029569

DomainStartEndE-ValueType
SCOP:d1jxqa_ 29 167 8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155179
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Tmem168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Tmem168 APN 6 13602675 missense probably benign 0.06
IGL01305:Tmem168 APN 6 13583046 missense probably damaging 1.00
IGL01843:Tmem168 APN 6 13582941 missense probably damaging 1.00
IGL02742:Tmem168 APN 6 13603262 missense probably benign 0.04
IGL02863:Tmem168 APN 6 13582918 missense probably damaging 0.98
ANU22:Tmem168 UTSW 6 13583046 missense probably damaging 1.00
R0193:Tmem168 UTSW 6 13583313 missense possibly damaging 0.81
R0537:Tmem168 UTSW 6 13603361 missense probably damaging 1.00
R0630:Tmem168 UTSW 6 13583065 missense probably benign
R0890:Tmem168 UTSW 6 13603272 missense probably damaging 1.00
R1416:Tmem168 UTSW 6 13591401 missense probably damaging 0.96
R1900:Tmem168 UTSW 6 13583071 missense probably benign 0.02
R3947:Tmem168 UTSW 6 13583052 missense probably damaging 1.00
R4362:Tmem168 UTSW 6 13595073 missense probably benign 0.31
R4620:Tmem168 UTSW 6 13594953 missense probably benign 0.03
R6142:Tmem168 UTSW 6 13591369 missense probably benign
R6328:Tmem168 UTSW 6 13602711 missense probably benign
R6438:Tmem168 UTSW 6 13602674 missense probably benign 0.06
R6711:Tmem168 UTSW 6 13603121 missense probably damaging 1.00
R6827:Tmem168 UTSW 6 13582838 missense probably damaging 0.99
R6987:Tmem168 UTSW 6 13591477 missense possibly damaging 0.82
R7696:Tmem168 UTSW 6 13602938 missense probably benign 0.01
R8295:Tmem168 UTSW 6 13602851 missense probably damaging 0.99
R8344:Tmem168 UTSW 6 13583325 missense probably benign
R8432:Tmem168 UTSW 6 13602536 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGCATAGGTATCCTGAGATCG -3'
(R):5'- GCTTTTCACTGCAATGATTGAGC -3'

Sequencing Primer
(F):5'- CTGAGATCGTCAGCATTTAGCAC -3'
(R):5'- GAGACACTCATCTCTGGTATTTTG -3'
Posted On2016-11-09