Incidental Mutation 'R5693:Vmn1r167'
ID443769
Institutional Source Beutler Lab
Gene Symbol Vmn1r167
Ensembl Gene ENSMUSG00000090715
Gene Namevomeronasal 1 receptor 167
SynonymsGm6279
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23503646-23507206 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 23505221 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 123 (Y123*)
Ref Sequence ENSEMBL: ENSMUSP00000153774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164527] [ENSMUST00000227713]
Predicted Effect probably null
Transcript: ENSMUST00000164527
AA Change: Y123*
SMART Domains Protein: ENSMUSP00000129193
Gene: ENSMUSG00000090715
AA Change: Y123*

DomainStartEndE-ValueType
Pfam:TAS2R 19 307 1.5e-13 PFAM
Pfam:7tm_1 41 299 3.8e-6 PFAM
Pfam:V1R 52 306 2.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227713
AA Change: Y123*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Vmn1r167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Vmn1r167 APN 7 23505439 missense probably damaging 0.98
IGL02261:Vmn1r167 APN 7 23504836 missense probably benign 0.17
IGL02963:Vmn1r167 APN 7 23505550 missense possibly damaging 0.60
R0054:Vmn1r167 UTSW 7 23504909 missense possibly damaging 0.89
R0555:Vmn1r167 UTSW 7 23505087 missense probably damaging 1.00
R0766:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1312:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1532:Vmn1r167 UTSW 7 23504779 missense probably benign 0.01
R1937:Vmn1r167 UTSW 7 23505027 missense probably benign 0.25
R2162:Vmn1r167 UTSW 7 23504799 missense possibly damaging 0.91
R4639:Vmn1r167 UTSW 7 23505586 missense probably benign 0.00
R4661:Vmn1r167 UTSW 7 23504692 missense probably damaging 1.00
R4845:Vmn1r167 UTSW 7 23504733 missense probably benign 0.01
R4868:Vmn1r167 UTSW 7 23504736 missense probably benign
R4993:Vmn1r167 UTSW 7 23505228 missense probably damaging 1.00
R6622:Vmn1r167 UTSW 7 23505589 start codon destroyed probably null
R7800:Vmn1r167 UTSW 7 23504644 makesense probably null
R8297:Vmn1r167 UTSW 7 23504790 missense probably damaging 1.00
R8365:Vmn1r167 UTSW 7 23504775 missense probably benign 0.03
R8411:Vmn1r167 UTSW 7 23505556 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GATGCGCATGCCTATACTGAAAC -3'
(R):5'- CATTCTAGCCAACTTAGCTGTGG -3'

Sequencing Primer
(F):5'- CATGCCTATACTGAAACCAGAGGTAG -3'
(R):5'- ACTTAGCTGTGGGCAATACC -3'
Posted On2016-11-09