Incidental Mutation 'R5693:Vmn1r183'
ID443770
Institutional Source Beutler Lab
Gene Symbol Vmn1r183
Ensembl Gene ENSMUSG00000066723
Gene Namevomeronasal 1 receptor 183
SynonymsLOC209824, V1rd15
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24054774-24055691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24054802 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 10 (T10I)
Ref Sequence ENSEMBL: ENSMUSP00000083176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086012
AA Change: T10I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083176
Gene: ENSMUSG00000066723
AA Change: T10I

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 5.6e-15 PFAM
Pfam:7tm_1 31 285 1.4e-9 PFAM
Pfam:V1R 41 296 2.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205855
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Vmn1r183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Vmn1r183 APN 7 24055224 missense probably damaging 1.00
IGL01813:Vmn1r183 APN 7 24055560 missense probably benign 0.19
IGL03377:Vmn1r183 APN 7 24055392 missense possibly damaging 0.70
PIT4791001:Vmn1r183 UTSW 7 24054841 missense probably damaging 0.99
R0463:Vmn1r183 UTSW 7 24055501 missense probably damaging 1.00
R0616:Vmn1r183 UTSW 7 24054825 missense probably benign 0.03
R0666:Vmn1r183 UTSW 7 24055176 missense probably benign
R3928:Vmn1r183 UTSW 7 24055572 missense probably damaging 0.98
R4425:Vmn1r183 UTSW 7 24055548 missense probably benign 0.00
R4767:Vmn1r183 UTSW 7 24055106 frame shift probably null
R4835:Vmn1r183 UTSW 7 24055139 missense probably benign 0.07
R5267:Vmn1r183 UTSW 7 24055546 missense possibly damaging 0.90
R6291:Vmn1r183 UTSW 7 24055557 missense possibly damaging 0.70
R6439:Vmn1r183 UTSW 7 24055279 missense possibly damaging 0.73
R7073:Vmn1r183 UTSW 7 24055501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCTCCAGGCAAAGTTCC -3'
(R):5'- CTTGGAGCAAAAGCCATCATG -3'

Sequencing Primer
(F):5'- CCAGGCAAAGTTCCTTTATTGTG -3'
(R):5'- GGAGCAAAAGCCATCATGTTGTTTG -3'
Posted On2016-11-09