Incidental Mutation 'R5693:Slc10a2'
ID443774
Institutional Source Beutler Lab
Gene Symbol Slc10a2
Ensembl Gene ENSMUSG00000023073
Gene Namesolute carrier family 10, member 2
SynonymsASBT
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location5083219-5105351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5105128 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 19 (C19F)
Ref Sequence ENSEMBL: ENSMUSP00000023835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023835]
Predicted Effect probably damaging
Transcript: ENSMUST00000023835
AA Change: C19F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023835
Gene: ENSMUSG00000023073
AA Change: C19F

DomainStartEndE-ValueType
Pfam:SBF 39 220 1e-47 PFAM
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/bile acid cotransporter. This transporter is the primary mechanism for uptake of intestinal bile acids by apical cells in the distal ileum. Bile acids are the catabolic product of cholesterol metabolism, so this protein is also critical for cholesterol homeostasis. Mutations in this gene cause primary bile acid malabsorption (PBAM); muatations in this gene may also be associated with other diseases of the liver and intestines, such as familial hypertriglyceridemia (FHTG). [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially indistinguishable from wild-type in terms of survival, gross appearance and behavior. However, they do have defects in lipid absorption from the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Slc10a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc10a2 APN 8 5091668 missense probably damaging 0.96
IGL00504:Slc10a2 APN 8 5091667 missense probably benign 0.00
IGL00596:Slc10a2 APN 8 5091680 missense probably benign 0.00
IGL01472:Slc10a2 APN 8 5091652 missense probably damaging 1.00
IGL02679:Slc10a2 APN 8 5098499 missense probably damaging 1.00
gall UTSW 8 5091621 critical splice donor site probably null
R0560:Slc10a2 UTSW 8 5089092 missense probably benign 0.02
R0629:Slc10a2 UTSW 8 5098562 missense probably benign 0.30
R0743:Slc10a2 UTSW 8 5089132 missense probably damaging 0.99
R0970:Slc10a2 UTSW 8 5105115 missense probably benign 0.00
R1033:Slc10a2 UTSW 8 5104889 missense probably damaging 0.99
R1557:Slc10a2 UTSW 8 5091755 missense probably damaging 1.00
R1808:Slc10a2 UTSW 8 5104856 missense probably damaging 0.96
R3620:Slc10a2 UTSW 8 5104909 missense probably damaging 0.99
R4084:Slc10a2 UTSW 8 5089126 missense possibly damaging 0.71
R4112:Slc10a2 UTSW 8 5105135 missense probably benign
R6294:Slc10a2 UTSW 8 5091621 critical splice donor site probably null
R6459:Slc10a2 UTSW 8 5098581 splice site probably null
R7442:Slc10a2 UTSW 8 5089086 missense possibly damaging 0.80
Z1177:Slc10a2 UTSW 8 5098448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTACAGGAAGGATGCCAG -3'
(R):5'- GAGACACCAAGTACCACATGTTG -3'

Sequencing Primer
(F):5'- CCTGTGAGAGGCATGATTCCAAAC -3'
(R):5'- CCAAGTACCACATGTTGAGAAAG -3'
Posted On2016-11-09