Incidental Mutation 'R5693:Rfx1'
ID443775
Institutional Source Beutler Lab
Gene Symbol Rfx1
Ensembl Gene ENSMUSG00000031706
Gene Nameregulatory factor X, 1 (influences HLA class II expression)
Synonyms
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84066834-84096992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84073904 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 45 (Q45K)
Ref Sequence ENSEMBL: ENSMUSP00000147677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005600] [ENSMUST00000211046]
Predicted Effect unknown
Transcript: ENSMUST00000005600
AA Change: Q45K
SMART Domains Protein: ENSMUSP00000005600
Gene: ENSMUSG00000031706
AA Change: Q45K

DomainStartEndE-ValueType
low complexity region 11 47 N/A INTRINSIC
low complexity region 53 67 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
Pfam:RFX1_trans_act 106 176 9.6e-9 PFAM
Pfam:RFX1_trans_act 211 366 1.8e-59 PFAM
Pfam:RFX_DNA_binding 420 498 2.5e-35 PFAM
Blast:HisKA 705 768 3e-28 BLAST
low complexity region 908 920 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210660
Predicted Effect unknown
Transcript: ENSMUST00000211046
AA Change: Q45K
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulatory factor X (RFX) family of transcription factors, which are characterized by a winged-helix DNA-binding domain. The encoded transcription factor contains an N-terminal activation domain and a C-terminal repression domain, and may activate or repress target gene expression depending on cellular context. This transcription factor has been shown to regulate a wide variety of genes involved in immunity and cancer, including the MHC class II genes and genes that may be involved in cancer progression. This gene exhibits altered expression in glioblastoma and the autoimmune disease systemic lupus erythematosis (SLE). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Rfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Rfx1 APN 8 84092972 critical splice acceptor site probably null
IGL01779:Rfx1 APN 8 84092662 splice site probably benign
IGL02505:Rfx1 APN 8 84095809 missense possibly damaging 0.79
IGL02741:Rfx1 APN 8 84095842 missense possibly damaging 0.94
R1565:Rfx1 UTSW 8 84073946 missense probably benign
R1793:Rfx1 UTSW 8 84066421 unclassified probably benign
R1808:Rfx1 UTSW 8 84095048 missense probably damaging 1.00
R1971:Rfx1 UTSW 8 84095497 missense probably damaging 1.00
R4542:Rfx1 UTSW 8 84090237 missense probably damaging 1.00
R4690:Rfx1 UTSW 8 84082745 missense possibly damaging 0.50
R4995:Rfx1 UTSW 8 84080114 splice site probably null
R5163:Rfx1 UTSW 8 84093211 missense probably damaging 0.98
R5212:Rfx1 UTSW 8 84066592 unclassified probably benign
R5227:Rfx1 UTSW 8 84074058 missense probably damaging 0.99
R5401:Rfx1 UTSW 8 84066376 splice site probably null
R5431:Rfx1 UTSW 8 84082720 nonsense probably null
R5584:Rfx1 UTSW 8 84088077 splice site probably null
R6210:Rfx1 UTSW 8 84093018 missense probably damaging 1.00
R6715:Rfx1 UTSW 8 84095815 missense possibly damaging 0.49
R6920:Rfx1 UTSW 8 84095488 missense probably damaging 1.00
R7131:Rfx1 UTSW 8 84095079 missense probably damaging 0.96
R7155:Rfx1 UTSW 8 84094826 missense probably damaging 0.99
R7336:Rfx1 UTSW 8 84073756 start gained probably benign
R7467:Rfx1 UTSW 8 84073913 missense possibly damaging 0.86
R8105:Rfx1 UTSW 8 84087876 missense possibly damaging 0.92
R8145:Rfx1 UTSW 8 84074028 missense probably benign 0.06
R8261:Rfx1 UTSW 8 84092850 missense probably benign 0.00
R8263:Rfx1 UTSW 8 84094854 missense probably damaging 1.00
R8443:Rfx1 UTSW 8 84079886 missense probably benign 0.00
Z1177:Rfx1 UTSW 8 84090277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCTTTTCTACTCAAGGAAGAG -3'
(R):5'- AGATGTTCCAAGCACTCTGGC -3'

Sequencing Primer
(F):5'- TTTCTACTCAAGGAAGAGGAAAACC -3'
(R):5'- CTCTGGCCACAAGTACAGATGTG -3'
Posted On2016-11-09