Incidental Mutation 'R5693:Thyn1'
ID443776
Institutional Source Beutler Lab
Gene Symbol Thyn1
Ensembl Gene ENSMUSG00000035443
Gene Namethymocyte nuclear protein 1
SynonymsThy28, D730042P09Rik
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location26999710-27007336 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 27005215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034470] [ENSMUST00000039161] [ENSMUST00000213683] [ENSMUST00000213770]
Predicted Effect probably benign
Transcript: ENSMUST00000034470
SMART Domains Protein: ENSMUSP00000034470
Gene: ENSMUSG00000031988

DomainStartEndE-ValueType
Pfam:Vps26 6 281 1e-135 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039161
SMART Domains Protein: ENSMUSP00000037614
Gene: ENSMUSG00000035443

DomainStartEndE-ValueType
Pfam:EVE 56 220 3.7e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213683
Predicted Effect probably null
Transcript: ENSMUST00000213770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217143
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly conserved among vertebrates and plant species and may be involved in the induction of apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Thyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Thyn1 APN 9 27003774 missense probably benign 0.17
Conception UTSW 9 27005213 missense probably damaging 1.00
R1747:Thyn1 UTSW 9 27005213 missense probably damaging 1.00
R1858:Thyn1 UTSW 9 27003774 missense probably benign 0.17
R2509:Thyn1 UTSW 9 27000020 missense possibly damaging 0.92
R4407:Thyn1 UTSW 9 27003597 missense possibly damaging 0.94
R6998:Thyn1 UTSW 9 27006442 missense probably damaging 0.98
R7219:Thyn1 UTSW 9 27005210 missense probably damaging 1.00
R7703:Thyn1 UTSW 9 27006847 missense probably benign 0.01
R8283:Thyn1 UTSW 9 27006859 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TAGCTCCTTTACAGCTGTAGC -3'
(R):5'- TCCTAGCCTTGTTCCAGGAC -3'

Sequencing Primer
(F):5'- ACAGCTGTAGCACTTTTCAGG -3'
(R):5'- TTGTTCCAGGACACTAGCCAG -3'
Posted On2016-11-09