Incidental Mutation 'R5693:Olfr798'
ID443780
Institutional Source Beutler Lab
Gene Symbol Olfr798
Ensembl Gene ENSMUSG00000095002
Gene Nameolfactory receptor 798
SynonymsGA_x6K02T2PULF-11304679-11303744, MOR108-1
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129622615-129627934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129625527 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 178 (D178G)
Ref Sequence ENSEMBL: ENSMUSP00000144716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079810] [ENSMUST00000204979]
Predicted Effect probably damaging
Transcript: ENSMUST00000079810
AA Change: D178G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078739
Gene: ENSMUSG00000095002
AA Change: D178G

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203614
Predicted Effect probably damaging
Transcript: ENSMUST00000204979
AA Change: D178G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144716
Gene: ENSMUSG00000095002
AA Change: D178G

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Olfr798
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr798 APN 10 129625563 missense probably damaging 1.00
IGL02866:Olfr798 APN 10 129625706 nonsense probably null
BB009:Olfr798 UTSW 10 129625225 missense probably damaging 0.97
BB019:Olfr798 UTSW 10 129625225 missense probably damaging 0.97
R0743:Olfr798 UTSW 10 129625843 missense probably benign 0.03
R1163:Olfr798 UTSW 10 129625647 missense possibly damaging 0.79
R1192:Olfr798 UTSW 10 129626037 missense probably benign
R1863:Olfr798 UTSW 10 129625348 missense probably damaging 0.96
R1867:Olfr798 UTSW 10 129625752 missense probably damaging 0.99
R2508:Olfr798 UTSW 10 129625915 missense probably benign
R4898:Olfr798 UTSW 10 129625599 missense probably benign 0.12
R4910:Olfr798 UTSW 10 129625807 missense probably damaging 0.98
R4988:Olfr798 UTSW 10 129626061 splice site probably null
R5361:Olfr798 UTSW 10 129625732 missense probably damaging 1.00
R5382:Olfr798 UTSW 10 129626007 missense probably damaging 0.98
R5589:Olfr798 UTSW 10 129625450 missense probably damaging 1.00
R5790:Olfr798 UTSW 10 129625888 missense probably damaging 1.00
R6966:Olfr798 UTSW 10 129625764 missense probably benign 0.17
R7041:Olfr798 UTSW 10 129625734 missense probably damaging 1.00
R7082:Olfr798 UTSW 10 129625765 missense probably benign 0.07
R7932:Olfr798 UTSW 10 129625225 missense probably damaging 0.97
R7977:Olfr798 UTSW 10 129625969 missense probably benign
R7987:Olfr798 UTSW 10 129625969 missense probably benign
R8299:Olfr798 UTSW 10 129625960 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGTTGAGCACTGCTATACC -3'
(R):5'- AGCTATCTGTAAGCCCTTGC -3'

Sequencing Primer
(F):5'- GTGTTGAGCACTGCTATACCCTTAG -3'
(R):5'- AGCTATCTGTAAGCCCTTGCATTAC -3'
Posted On2016-11-09