Incidental Mutation 'R5693:Pacs2'
ID443785
Institutional Source Beutler Lab
Gene Symbol Pacs2
Ensembl Gene ENSMUSG00000021143
Gene Namephosphofurin acidic cluster sorting protein 2
Synonyms6720425G15Rik, Pacs1l
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113014508-113074401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113049906 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 175 (S175P)
Ref Sequence ENSEMBL: ENSMUSP00000152439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084891] [ENSMUST00000220541] [ENSMUST00000222406] [ENSMUST00000223502]
Predicted Effect probably damaging
Transcript: ENSMUST00000084891
AA Change: S175P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081953
Gene: ENSMUSG00000021143
AA Change: S175P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 281 296 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
Pfam:Pacs-1 474 888 1.4e-208 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220541
AA Change: S145P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000222406
Predicted Effect probably damaging
Transcript: ENSMUST00000223502
AA Change: S175P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased sensitivity to TRAIL-induced spleen apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Pacs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Pacs2 APN 12 113056842 missense probably benign 0.01
IGL01830:Pacs2 APN 12 113056954 nonsense probably null
IGL02229:Pacs2 APN 12 113056800 splice site probably benign
IGL02307:Pacs2 APN 12 113070773 missense probably damaging 1.00
IGL02700:Pacs2 APN 12 113061710 missense probably damaging 1.00
BB003:Pacs2 UTSW 12 113060752 missense probably damaging 1.00
BB013:Pacs2 UTSW 12 113060752 missense probably damaging 1.00
R0241:Pacs2 UTSW 12 113069270 splice site probably benign
R0433:Pacs2 UTSW 12 113056844 missense possibly damaging 0.77
R0512:Pacs2 UTSW 12 113050927 missense probably damaging 0.99
R0761:Pacs2 UTSW 12 113060068 splice site probably benign
R2017:Pacs2 UTSW 12 113062457 missense probably damaging 1.00
R2070:Pacs2 UTSW 12 113061111 missense probably damaging 1.00
R2162:Pacs2 UTSW 12 113050947 missense probably benign
R2231:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2232:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2396:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R2397:Pacs2 UTSW 12 113063367 missense probably damaging 1.00
R3010:Pacs2 UTSW 12 113061080 missense probably benign
R3403:Pacs2 UTSW 12 113050950 missense probably damaging 1.00
R3950:Pacs2 UTSW 12 113061113 missense probably damaging 1.00
R3952:Pacs2 UTSW 12 113061113 missense probably damaging 1.00
R4518:Pacs2 UTSW 12 113060669 missense probably benign 0.31
R5673:Pacs2 UTSW 12 113068998 missense probably damaging 1.00
R7212:Pacs2 UTSW 12 113061692 missense possibly damaging 0.77
R7926:Pacs2 UTSW 12 113060752 missense probably damaging 1.00
R8032:Pacs2 UTSW 12 113061658 missense probably damaging 1.00
R8224:Pacs2 UTSW 12 113059760 missense probably damaging 1.00
Z1177:Pacs2 UTSW 12 113070730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCCTGCTCCTGAATATTG -3'
(R):5'- TGGCACCTACATATCGAGGG -3'

Sequencing Primer
(F):5'- CTCCTGAATATTGGAGCTCTCTGG -3'
(R):5'- GCACCTACATATCGAGGGTTCAG -3'
Posted On2016-11-09