Incidental Mutation 'R5693:Gata4'
ID443786
Institutional Source Beutler Lab
Gene Symbol Gata4
Ensembl Gene ENSMUSG00000021944
Gene NameGATA binding protein 4
SynonymsGata-4
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5693 (G1)
Quality Score135
Status Not validated
Chromosome14
Chromosomal Location63198922-63271692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63241145 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 2 (Y2H)
Ref Sequence ENSEMBL: ENSMUSP00000113891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067417] [ENSMUST00000118022] [ENSMUST00000132122] [ENSMUST00000137244] [ENSMUST00000156782]
Predicted Effect probably damaging
Transcript: ENSMUST00000067417
AA Change: Y2H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066927
Gene: ENSMUSG00000021944
AA Change: Y2H

DomainStartEndE-ValueType
Pfam:GATA-N 1 204 2.2e-54 PFAM
ZnF_GATA 211 261 4.36e-18 SMART
ZnF_GATA 265 315 1.02e-23 SMART
low complexity region 342 360 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118022
AA Change: Y2H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113891
Gene: ENSMUSG00000021944
AA Change: Y2H

DomainStartEndE-ValueType
Pfam:GATA-N 1 207 7.8e-54 PFAM
ZnF_GATA 210 260 4.36e-18 SMART
ZnF_GATA 264 314 1.02e-23 SMART
low complexity region 341 359 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132122
AA Change: Y2H
Predicted Effect unknown
Transcript: ENSMUST00000137244
AA Change: Y2H
Predicted Effect unknown
Transcript: ENSMUST00000156782
AA Change: Y2H
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in ventral morphogenesis, lack a primitive heart tube and foregut, develop partially outside the yolk sac, and die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Gata4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Gata4 APN 14 63200463 missense possibly damaging 0.53
IGL02481:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02483:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02643:Gata4 APN 14 63204755 missense possibly damaging 0.85
R0034:Gata4 UTSW 14 63201484 missense probably benign 0.00
R0043:Gata4 UTSW 14 63203301 splice site probably benign
R1131:Gata4 UTSW 14 63204740 missense possibly damaging 0.71
R1880:Gata4 UTSW 14 63204695 missense probably damaging 1.00
R3500:Gata4 UTSW 14 63200533 missense possibly damaging 0.84
R3949:Gata4 UTSW 14 63240697 missense possibly damaging 0.95
R4893:Gata4 UTSW 14 63201596 missense probably benign 0.01
R4976:Gata4 UTSW 14 63203689 missense probably damaging 1.00
R5152:Gata4 UTSW 14 63241121 missense probably damaging 1.00
R5198:Gata4 UTSW 14 63200451 missense probably benign 0.09
R5237:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5291:Gata4 UTSW 14 63240599 missense probably damaging 0.98
R5358:Gata4 UTSW 14 63240626 missense probably benign 0.28
R7143:Gata4 UTSW 14 63204617 missense probably damaging 1.00
R7299:Gata4 UTSW 14 63203742 missense probably damaging 1.00
R7729:Gata4 UTSW 14 63240737 missense probably benign 0.00
R7849:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
R8186:Gata4 UTSW 14 63201513 missense probably benign 0.00
Z1177:Gata4 UTSW 14 63200382 missense probably damaging 0.99
Z1177:Gata4 UTSW 14 63241265 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTAACTCACCGAGATTGGGG -3'
(R):5'- ATATATTTTGAGCGAGTTGGGCCTC -3'

Sequencing Primer
(F):5'- AGGTGGTTCCAGCTGCAG -3'
(R):5'- TTTTGGTGACAGTTCCGC -3'
Posted On2016-11-09