Mutagenetix > Incidental Mutations

Incidental Mutation 'R5693:Adcy6'

443787

Institutional Source

Beutler Lab

Gene Symbol

Adcy6

Ensembl Gene

ENSMUSG00000022994

Gene Name

adenylate cyclase 6

Synonyms

MMRRC Submission

043180-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5693 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98589973-98610076 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98603989 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 248 (Y248C)

Ref Sequence

ENSEMBL: ENSMUSP00000154696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096224] [ENSMUST00000226500] [ENSMUST00000227501] [ENSMUST00000228566] [ENSMUST00000228903]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096224
AA Change: Y248C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994
AA Change: Y248C

Domain	Start	End	E-Value	Type
low complexity region	150	166	N/A	INTRINSIC
low complexity region	169	177	N/A	INTRINSIC
low complexity region	212	228	N/A	INTRINSIC
CYCc	331	532	2.95e-63	SMART
Pfam:DUF1053	580	669	3.5e-18	PFAM
transmembrane domain	701	723	N/A	INTRINSIC
transmembrane domain	744	763	N/A	INTRINSIC
transmembrane domain	815	834	N/A	INTRINSIC
transmembrane domain	839	861	N/A	INTRINSIC
Blast:CYCc	885	929	5e-20	BLAST
CYCc	939	1147	4.81e-45	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226500

Predicted Effect

probably benign
Transcript: ENSMUST00000227501

Predicted Effect

probably damaging
Transcript: ENSMUST00000228566
AA Change: Y248C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228903
AA Change: Y248C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,316,233	I3071V	probably benign	Het
Abcb8	C	T	5: 24,400,139	R108C	possibly damaging	Het
Abr	T	C	11: 76,463,577	N236S	probably damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Chd6	A	T	2: 160,965,265	S2010T	probably benign	Het
Dcc	G	A	18: 71,575,082	T521I	probably damaging	Het
Dmrtb1	G	A	4: 107,684,169		probably benign	Het
Evc	A	G	5: 37,320,240	V365A	possibly damaging	Het
Gata4	A	G	14: 63,241,145	Y2H	probably damaging	Het
Gpc1	A	G	1: 92,857,899	N437S	probably damaging	Het
Lifr	T	C	15: 7,175,560	V426A	probably damaging	Het
Lpin3	A	G	2: 160,895,400	I122M	probably benign	Het
Muc4	A	G	16: 32,776,807	N3174D	possibly damaging	Het
Myo6	G	A	9: 80,266,180	R534H	probably damaging	Het
Nectin2	T	C	7: 19,724,869	D339G	probably benign	Het
Olfr798	T	C	10: 129,625,527	D178G	probably damaging	Het
Oprd1	G	A	4: 132,144,410		probably benign	Het
Orc1	G	A	4: 108,613,079	V751I	probably benign	Het
Pacs2	T	C	12: 113,049,906	S175P	probably damaging	Het
Pik3r5	C	T	11: 68,494,251	R661C	probably damaging	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Prkar1b	A	G	5: 139,127,645	V40A	possibly damaging	Het
Ptprf	G	A	4: 118,236,177	R90*	probably null	Het
Rasef	T	C	4: 73,769,839	M26V	probably damaging	Het
Rfx1	C	A	8: 84,073,904	Q45K	unknown	Het
Rnf183	A	G	4: 62,428,516	V15A	possibly damaging	Het
Slc10a2	C	A	8: 5,105,128	C19F	probably damaging	Het
Slc14a2	T	A	18: 78,147,014	I907F	probably benign	Het
Snx16	T	C	3: 10,420,258	I293V	probably benign	Het
Srcap	C	A	7: 127,519,816	A97E	probably damaging	Het
Thyn1	G	T	9: 27,005,215		probably null	Het
Tiparp	T	C	3: 65,553,492	I634T	possibly damaging	Het
Tjp1	G	A	7: 65,342,663	A156V	possibly damaging	Het
Tmem168	T	C	6: 13,602,321	M349V	probably benign	Het
Tyro3	T	G	2: 119,810,868	F519L	probably damaging	Het
Vmn1r167	A	T	7: 23,505,221	Y123*	probably null	Het
Vmn1r183	C	T	7: 24,054,802	T10I	possibly damaging	Het
Zfp654	T	C	16: 64,785,926	T97A	probably benign	Het

Other mutations in Adcy6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Adcy6	APN	15	98598976	missense	probably damaging	1.00
IGL01132:Adcy6	APN	15	98597851	missense	probably benign	0.14
IGL01642:Adcy6	APN	15	98594509	missense	possibly damaging	0.88
IGL01647:Adcy6	APN	15	98600275	missense	probably damaging	1.00
IGL01788:Adcy6	APN	15	98596519	nonsense	probably null
IGL02122:Adcy6	APN	15	98598882	missense	possibly damaging	0.66
IGL02210:Adcy6	APN	15	98594971	missense	possibly damaging	0.63
IGL02249:Adcy6	APN	15	98599914	missense	probably damaging	1.00
IGL02404:Adcy6	APN	15	98596938	missense	probably benign
IGL02691:Adcy6	APN	15	98604304	missense	probably damaging	1.00
PIT4515001:Adcy6	UTSW	15	98595146	missense	probably benign	0.04
R0178:Adcy6	UTSW	15	98604215	missense	probably benign	0.00
R0497:Adcy6	UTSW	15	98597725	critical splice donor site	probably null
R0739:Adcy6	UTSW	15	98598379	missense	probably benign	0.00
R1454:Adcy6	UTSW	15	98604728	missense	probably damaging	1.00
R1473:Adcy6	UTSW	15	98592743	missense	probably damaging	0.99
R1536:Adcy6	UTSW	15	98600007	missense	probably damaging	1.00
R1927:Adcy6	UTSW	15	98598498	splice site	probably null
R2178:Adcy6	UTSW	15	98594355	missense	probably damaging	1.00
R2294:Adcy6	UTSW	15	98597441	missense	possibly damaging	0.48
R2356:Adcy6	UTSW	15	98597016	splice site	probably null
R2898:Adcy6	UTSW	15	98593488	missense	probably damaging	1.00
R3001:Adcy6	UTSW	15	98596660	missense	probably benign	0.01
R3002:Adcy6	UTSW	15	98596660	missense	probably benign	0.01
R3794:Adcy6	UTSW	15	98598943	missense	probably damaging	1.00
R3884:Adcy6	UTSW	15	98597174	missense	probably benign	0.06
R4348:Adcy6	UTSW	15	98604160	missense	probably benign	0.44
R4351:Adcy6	UTSW	15	98604160	missense	probably benign	0.44
R4542:Adcy6	UTSW	15	98598988	missense	possibly damaging	0.70
R4548:Adcy6	UTSW	15	98598659	missense	probably damaging	1.00
R5707:Adcy6	UTSW	15	98598741	missense	probably damaging	1.00
R5994:Adcy6	UTSW	15	98593664	missense	probably damaging	1.00
R5998:Adcy6	UTSW	15	98594354	nonsense	probably null
R6142:Adcy6	UTSW	15	98598422	missense	probably benign
R6242:Adcy6	UTSW	15	98604015	nonsense	probably null
R6305:Adcy6	UTSW	15	98598645	missense	probably benign	0.13
R6751:Adcy6	UTSW	15	98596205	missense	probably benign
R7130:Adcy6	UTSW	15	98597229	missense	probably benign
R7335:Adcy6	UTSW	15	98603876	missense	probably benign	0.29
R7643:Adcy6	UTSW	15	98593568	missense	probably benign
R7658:Adcy6	UTSW	15	98596067	missense	probably benign	0.00
R7748:Adcy6	UTSW	15	98604556	missense	probably benign	0.01
R7761:Adcy6	UTSW	15	98600014	missense	probably damaging	1.00
R7774:Adcy6	UTSW	15	98596533	missense	probably benign
R7954:Adcy6	UTSW	15	98596892	critical splice donor site	probably null
R8259:Adcy6	UTSW	15	98601038	missense	probably damaging	0.97
R8260:Adcy6	UTSW	15	98601038	missense	probably damaging	0.97
R8520:Adcy6	UTSW	15	98604160	missense	probably benign
X0020:Adcy6	UTSW	15	98598735	missense	probably damaging	0.99
X0021:Adcy6	UTSW	15	98603942	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GATACTGTGTCCCTCCATCAGC -3'
(R):5'- ACTGTTGACTTTCCACGCTG -3'

Sequencing Primer
(F):5'- GTGTCCCTCCATCAGCAAGTTC -3'
(R):5'- AGCCTCAGCCTGCTTACGTG -3'

Posted On

2016-11-09