Incidental Mutation 'R5693:Zfp654'
ID443791
Institutional Source Beutler Lab
Gene Symbol Zfp654
Ensembl Gene ENSMUSG00000047141
Gene Namezinc finger protein 654
Synonyms1810008K20Rik, 1600021C16Rik
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location64780347-64851652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64785926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 97 (T97A)
Ref Sequence ENSEMBL: ENSMUSP00000052946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052588] [ENSMUST00000207826]
Predicted Effect probably benign
Transcript: ENSMUST00000052588
AA Change: T97A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052946
Gene: ENSMUSG00000047141
AA Change: T97A

DomainStartEndE-ValueType
ZnF_C2H2 25 47 1.69e-3 SMART
low complexity region 117 132 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
ZnF_C2H2 197 222 1.25e-1 SMART
ZnF_C2H2 238 260 4.65e-1 SMART
ZnF_C2H2 266 290 4.98e-1 SMART
ZnF_C2H2 295 319 7.49e0 SMART
ZnF_C2H2 534 554 1.49e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207826
AA Change: T638A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Other mutations in Zfp654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp654 APN 16 64784641 missense probably benign 0.02
IGL02043:Zfp654 APN 16 64785028 missense probably benign 0.00
IGL02205:Zfp654 APN 16 64785966 missense probably damaging 1.00
IGL02337:Zfp654 APN 16 64785149 missense probably benign 0.00
IGL02398:Zfp654 APN 16 64786018 missense probably benign 0.00
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0193:Zfp654 UTSW 16 64785688 missense possibly damaging 0.76
R1276:Zfp654 UTSW 16 64785336 missense probably damaging 1.00
R1851:Zfp654 UTSW 16 64785128 missense probably benign 0.34
R4065:Zfp654 UTSW 16 64785925 missense possibly damaging 0.87
R4872:Zfp654 UTSW 16 64785782 missense probably benign 0.28
R6362:Zfp654 UTSW 16 64786094 nonsense probably null
R6483:Zfp654 UTSW 16 64791947 missense possibly damaging 0.93
R6666:Zfp654 UTSW 16 64786233 missense probably benign 0.25
R6852:Zfp654 UTSW 16 64786598 missense probably damaging 1.00
R6917:Zfp654 UTSW 16 64786471 missense probably damaging 0.98
R7289:Zfp654 UTSW 16 64785160 missense probably benign
R7506:Zfp654 UTSW 16 64791848 missense probably damaging 0.98
R7598:Zfp654 UTSW 16 64785934 missense possibly damaging 0.49
R7721:Zfp654 UTSW 16 64786207 missense probably damaging 1.00
R7791:Zfp654 UTSW 16 64783271 makesense probably null
R7884:Zfp654 UTSW 16 64851648 missense probably damaging 0.99
R7966:Zfp654 UTSW 16 64784876 missense probably damaging 1.00
R8361:Zfp654 UTSW 16 64791857 missense probably damaging 1.00
Z1176:Zfp654 UTSW 16 64786208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGCACTGATGTTTCTTGATTC -3'
(R):5'- GGCCACATTGTAAGGCATGC -3'

Sequencing Primer
(F):5'- GCACTGATGTTTCTTGATTCAAATC -3'
(R):5'- CACATTGTAAGGCATGCCCAGG -3'
Posted On2016-11-09