Incidental Mutation 'R5694:Rnpepl1'
ID443795
Institutional Source Beutler Lab
Gene Symbol Rnpepl1
Ensembl Gene ENSMUSG00000026269
Gene Namearginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92910783-92924384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92918941 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 522 (S522P)
Ref Sequence ENSEMBL: ENSMUSP00000027487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027487] [ENSMUST00000178116]
Predicted Effect probably benign
Transcript: ENSMUST00000027487
AA Change: S522P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027487
Gene: ENSMUSG00000026269
AA Change: S522P

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
Pfam:Peptidase_M1 36 440 3e-58 PFAM
Leuk-A4-hydro_C 523 668 1.31e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178116
SMART Domains Protein: ENSMUSP00000136080
Gene: ENSMUSG00000026269

DomainStartEndE-ValueType
Pfam:Peptidase_M1 5 170 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178816
Predicted Effect unknown
Transcript: ENSMUST00000179127
AA Change: S176P
Predicted Effect probably benign
Transcript: ENSMUST00000179531
Predicted Effect unknown
Transcript: ENSMUST00000179837
AA Change: S92P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179854
Predicted Effect probably benign
Transcript: ENSMUST00000179993
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Rnpepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Rnpepl1 APN 1 92915899 missense possibly damaging 0.69
IGL01291:Rnpepl1 APN 1 92919746 missense probably benign
IGL02266:Rnpepl1 APN 1 92916889 missense probably damaging 1.00
IGL02481:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL02483:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL03377:Rnpepl1 APN 1 92919231 missense probably benign 0.01
ANU05:Rnpepl1 UTSW 1 92919746 missense probably benign
R0069:Rnpepl1 UTSW 1 92918898 missense possibly damaging 0.91
R0409:Rnpepl1 UTSW 1 92915860 missense probably damaging 1.00
R0479:Rnpepl1 UTSW 1 92918865 unclassified probably benign
R1155:Rnpepl1 UTSW 1 92916887 missense probably damaging 1.00
R1170:Rnpepl1 UTSW 1 92919195 missense possibly damaging 0.56
R1397:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R1601:Rnpepl1 UTSW 1 92917222 missense possibly damaging 0.95
R2184:Rnpepl1 UTSW 1 92916823 missense probably benign 0.43
R2187:Rnpepl1 UTSW 1 92916895 missense probably null 1.00
R2211:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R2902:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3105:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3196:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R3439:Rnpepl1 UTSW 1 92916940 missense possibly damaging 0.94
R4887:Rnpepl1 UTSW 1 92915113 missense probably damaging 1.00
R4966:Rnpepl1 UTSW 1 92916761 missense probably damaging 1.00
R5212:Rnpepl1 UTSW 1 92911323 missense probably benign 0.03
R5214:Rnpepl1 UTSW 1 92919279 missense probably benign 0.01
R5385:Rnpepl1 UTSW 1 92917192 missense probably damaging 1.00
R5655:Rnpepl1 UTSW 1 92919310 missense probably damaging 1.00
R5940:Rnpepl1 UTSW 1 92917712 missense probably damaging 1.00
R6046:Rnpepl1 UTSW 1 92916821 missense probably damaging 1.00
R6086:Rnpepl1 UTSW 1 92917681 missense probably damaging 1.00
R6104:Rnpepl1 UTSW 1 92915884 missense probably benign
R6349:Rnpepl1 UTSW 1 92919841 missense probably damaging 1.00
R7381:Rnpepl1 UTSW 1 92919195 missense possibly damaging 0.56
R7402:Rnpepl1 UTSW 1 92919650 missense probably benign 0.01
R7474:Rnpepl1 UTSW 1 92918972 missense probably benign 0.14
R7714:Rnpepl1 UTSW 1 92917168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGAAGAGATCACCTGCC -3'
(R):5'- CACTTGGACAGGCTCATCAC -3'

Sequencing Primer
(F):5'- TACCCTTTGGGCTTGGAG -3'
(R):5'- AGGCTACCCTGTTGACCG -3'
Posted On2016-11-09