Incidental Mutation 'R5694:Cat'
ID443806
Institutional Source Beutler Lab
Gene Symbol Cat
Ensembl Gene ENSMUSG00000027187
Gene Namecatalase
SynonymsCas1, Cas-1, Cs-1
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103453849-103485160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103472994 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 146 (V146E)
Ref Sequence ENSEMBL: ENSMUSP00000028610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028610] [ENSMUST00000111168]
Predicted Effect probably damaging
Transcript: ENSMUST00000028610
AA Change: V146E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028610
Gene: ENSMUSG00000027187
AA Change: V146E

DomainStartEndE-ValueType
Catalase 28 413 4.7e-285 SMART
Pfam:Catalase-rel 434 497 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111168
SMART Domains Protein: ENSMUSP00000106798
Gene: ENSMUSG00000027187

DomainStartEndE-ValueType
Catalase 28 176 2.33e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype although subtle abnormalities do occur in mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Cat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02989:Cat APN 2 103472973 missense probably damaging 1.00
PIT4696001:Cat UTSW 2 103471812 missense probably damaging 0.99
R1968:Cat UTSW 2 103484989 missense probably benign 0.01
R2103:Cat UTSW 2 103463315 missense probably damaging 1.00
R2655:Cat UTSW 2 103471846 missense probably damaging 1.00
R3037:Cat UTSW 2 103467777 missense probably benign 0.07
R5287:Cat UTSW 2 103474360 missense probably damaging 1.00
R5527:Cat UTSW 2 103472973 missense probably damaging 1.00
R6089:Cat UTSW 2 103472951 missense probably null 0.48
R6177:Cat UTSW 2 103473075 missense probably damaging 1.00
R6281:Cat UTSW 2 103471769 missense probably damaging 1.00
R6294:Cat UTSW 2 103460295 missense probably benign
R7058:Cat UTSW 2 103474353 missense probably benign 0.31
R7274:Cat UTSW 2 103476890 missense probably benign 0.07
R7347:Cat UTSW 2 103463298 missense probably benign
R7654:Cat UTSW 2 103460364 missense probably damaging 1.00
R7762:Cat UTSW 2 103456858 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCCAATGGTAATTATCACTTGATC -3'
(R):5'- TGGACTGAAGATGGTAGATGC -3'

Sequencing Primer
(F):5'- TGGACTGAACCTCTGCAACTGTAAG -3'
(R):5'- ACTGAAGATGGTAGATGCTAGGTTTC -3'
Posted On2016-11-09