Incidental Mutation 'R5694:Siglech'
ID443819
Institutional Source Beutler Lab
Gene Symbol Siglech
Ensembl Gene ENSMUSG00000051504
Gene Namesialic acid binding Ig-like lectin H
Synonyms6430529G09Rik, Siglec-H
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location55768178-55778925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55768656 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 124 (F124Y)
Ref Sequence ENSEMBL: ENSMUSP00000130943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060416] [ENSMUST00000094360] [ENSMUST00000121492] [ENSMUST00000154933] [ENSMUST00000165045] [ENSMUST00000171077] [ENSMUST00000172988] [ENSMUST00000173835]
Predicted Effect probably damaging
Transcript: ENSMUST00000060416
AA Change: F124Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058875
Gene: ENSMUSG00000051504
AA Change: F124Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 38 141 1.28e-1 SMART
IG_like 154 238 5.13e0 SMART
transmembrane domain 264 286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094360
AA Change: F124Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091920
Gene: ENSMUSG00000051504
AA Change: F124Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 38 141 1.28e-1 SMART
IG_like 154 238 5.13e0 SMART
transmembrane domain 248 270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121492
AA Change: F124Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113665
Gene: ENSMUSG00000051504
AA Change: F124Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 38 141 1.28e-1 SMART
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154933
Predicted Effect probably damaging
Transcript: ENSMUST00000165045
AA Change: F124Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130632
Gene: ENSMUSG00000051504
AA Change: F124Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 38 141 1.28e-1 SMART
IG_like 154 238 5.13e0 SMART
transmembrane domain 263 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171077
AA Change: F124Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130943
Gene: ENSMUSG00000051504
AA Change: F124Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 38 141 1.28e-1 SMART
IG_like 154 238 5.13e0 SMART
transmembrane domain 264 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172988
SMART Domains Protein: ENSMUSP00000134017
Gene: ENSMUSG00000051504

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173835
AA Change: F124Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134721
Gene: ENSMUSG00000051504
AA Change: F124Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 38 141 1.28e-1 SMART
transmembrane domain 171 193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased T cell proliferation, increased BUN, vacuolated renal tubules, testicular atrophy and poor maturation of seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Siglech
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Siglech APN 7 55772591 splice site probably benign
IGL00509:Siglech APN 7 55768887 missense possibly damaging 0.47
R0619:Siglech UTSW 7 55769162 missense probably benign 0.44
R1746:Siglech UTSW 7 55768504 missense probably benign 0.03
R1818:Siglech UTSW 7 55768584 missense probably damaging 1.00
R2125:Siglech UTSW 7 55771686 missense probably benign 0.04
R4611:Siglech UTSW 7 55771693 missense probably damaging 1.00
R4835:Siglech UTSW 7 55768429 nonsense probably null
R5531:Siglech UTSW 7 55768665 nonsense probably null
R5724:Siglech UTSW 7 55768545 missense probably damaging 1.00
R6597:Siglech UTSW 7 55768463 missense probably benign 0.01
R7881:Siglech UTSW 7 55772541 missense probably benign 0.29
R7964:Siglech UTSW 7 55772541 missense probably benign 0.29
Z1088:Siglech UTSW 7 55768994 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATTGAGTACCCCATGAACAGG -3'
(R):5'- ACAGCTACTGAGAAGCCCAG -3'

Sequencing Primer
(F):5'- TACCCCATGAACAGGTGGTCAG -3'
(R):5'- GAGAAGCCCAGGTTTTGATTCAACTC -3'
Posted On2016-11-09