Incidental Mutation 'R5694:Unc5b'
ID443830
Institutional Source Beutler Lab
Gene Symbol Unc5b
Ensembl Gene ENSMUSG00000020099
Gene Nameunc-5 netrin receptor B
SynonymsUnc5h2, D10Bwg0792e, 6330415E02Rik
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location60762593-60831581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60773747 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 590 (T590I)
Ref Sequence ENSEMBL: ENSMUSP00000077080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077925] [ENSMUST00000218637]
PDB Structure
Crystal structure of the UNC5H2 death domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000077925
AA Change: T590I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: T590I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG_like 54 149 1.71e2 SMART
IGc2 165 232 2.58e-6 SMART
TSP1 249 300 8.21e-15 SMART
TSP1 305 354 2.61e-8 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
ZU5 541 644 1.91e-56 SMART
DEATH 852 943 5.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218316
Predicted Effect probably benign
Transcript: ENSMUST00000218637
AA Change: T579I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Unc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Unc5b APN 10 60783216 missense possibly damaging 0.73
IGL00578:Unc5b APN 10 60767055 missense probably damaging 1.00
IGL01895:Unc5b APN 10 60767085 missense probably damaging 1.00
IGL01955:Unc5b APN 10 60778255 missense probably benign 0.30
IGL01980:Unc5b APN 10 60780187 missense probably damaging 1.00
IGL02277:Unc5b APN 10 60774742 missense probably benign
LCD18:Unc5b UTSW 10 60786171 intron probably benign
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0026:Unc5b UTSW 10 60774592 missense possibly damaging 0.86
R0147:Unc5b UTSW 10 60772297 missense probably damaging 0.96
R0305:Unc5b UTSW 10 60779658 splice site probably benign
R0306:Unc5b UTSW 10 60779658 splice site probably benign
R0373:Unc5b UTSW 10 60778940 missense possibly damaging 0.78
R0662:Unc5b UTSW 10 60772583 missense possibly damaging 0.68
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1512:Unc5b UTSW 10 60831475 unclassified probably benign
R1532:Unc5b UTSW 10 60769232 missense probably damaging 0.99
R1916:Unc5b UTSW 10 60778248 missense probably damaging 1.00
R1931:Unc5b UTSW 10 60772569 missense probably benign 0.30
R1954:Unc5b UTSW 10 60769265 splice site probably benign
R2350:Unc5b UTSW 10 60778200 missense probably benign 0.04
R3419:Unc5b UTSW 10 60778814 missense probably damaging 1.00
R4116:Unc5b UTSW 10 60774700 missense probably damaging 0.99
R4258:Unc5b UTSW 10 60765371 missense probably damaging 0.99
R4329:Unc5b UTSW 10 60783190 missense probably damaging 1.00
R4605:Unc5b UTSW 10 60774403 missense probably benign 0.01
R4828:Unc5b UTSW 10 60772348 missense possibly damaging 0.90
R5134:Unc5b UTSW 10 60775100 missense probably benign 0.09
R5190:Unc5b UTSW 10 60772293 missense probably benign 0.04
R5240:Unc5b UTSW 10 60774640 missense probably damaging 0.99
R5342:Unc5b UTSW 10 60778267 nonsense probably null
R5522:Unc5b UTSW 10 60778195 missense possibly damaging 0.91
R5822:Unc5b UTSW 10 60772527 missense possibly damaging 0.71
R5909:Unc5b UTSW 10 60772359 missense probably damaging 1.00
R6007:Unc5b UTSW 10 60765360 missense probably damaging 1.00
R6115:Unc5b UTSW 10 60777546 missense probably benign 0.33
R6182:Unc5b UTSW 10 60765236 missense probably damaging 1.00
R6187:Unc5b UTSW 10 60772224 missense probably damaging 1.00
R6294:Unc5b UTSW 10 60778331 missense possibly damaging 0.82
R6319:Unc5b UTSW 10 60778801 missense probably damaging 1.00
R6366:Unc5b UTSW 10 60778312 missense probably benign
R6532:Unc5b UTSW 10 60778828 missense possibly damaging 0.95
R6827:Unc5b UTSW 10 60780232 missense probably benign
R6912:Unc5b UTSW 10 60831092 missense probably benign
R7032:Unc5b UTSW 10 60778808 missense probably damaging 0.99
R7082:Unc5b UTSW 10 60775088 missense probably damaging 0.98
R7089:Unc5b UTSW 10 60777486 missense probably damaging 1.00
R7270:Unc5b UTSW 10 60772223 nonsense probably null
R7587:Unc5b UTSW 10 60783120 missense probably damaging 1.00
R7716:Unc5b UTSW 10 60777438 missense probably damaging 1.00
R7750:Unc5b UTSW 10 60775044 missense probably benign 0.00
R7810:Unc5b UTSW 10 60765241 missense probably benign
R7895:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
R7978:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
RF019:Unc5b UTSW 10 60783183 missense probably damaging 1.00
X0027:Unc5b UTSW 10 60777459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTGCTTACCAATCCCC -3'
(R):5'- CCTGTATTCATGGGCAGACC -3'

Sequencing Primer
(F):5'- CCCCTTTGCACAGGAAAGGTTTG -3'
(R):5'- AAGTAGCCTGTGTGCTCCCTG -3'
Posted On2016-11-09